diff options
Diffstat (limited to 'pkgs/applications/science')
112 files changed, 919 insertions, 659 deletions
diff --git a/pkgs/applications/science/astronomy/gnuastro/default.nix b/pkgs/applications/science/astronomy/gnuastro/default.nix index 69f4011f273..a1fef6404e4 100644 --- a/pkgs/applications/science/astronomy/gnuastro/default.nix +++ b/pkgs/applications/science/astronomy/gnuastro/default.nix @@ -3,11 +3,11 @@ stdenv.mkDerivation rec { pname = "gnuastro"; - version = "0.20"; + version = "0.21"; src = fetchurl { url = "mirror://gnu/gnuastro/gnuastro-${version}.tar.gz"; - sha256 = "sha256-kkuLtqwc0VFj3a3Dqb/bi4jKx7UJnV+CHs7bw/Cwac0="; + sha256 = "sha256-L7qZPYQiORUXtV9+tRF4iUbXqIaqFYSYT9Rni90nU38="; }; nativeBuildInputs = [ libtool ]; diff --git a/pkgs/applications/science/astronomy/kstars/default.nix b/pkgs/applications/science/astronomy/kstars/default.nix index ce29c5172a2..14c684d432c 100644 --- a/pkgs/applications/science/astronomy/kstars/default.nix +++ b/pkgs/applications/science/astronomy/kstars/default.nix @@ -14,11 +14,11 @@ mkDerivation rec { pname = "kstars"; - version = "3.6.6"; + version = "3.6.7"; src = fetchurl { url = "mirror://kde/stable/kstars/kstars-${version}.tar.xz"; - sha256 = "sha256-Z4PatRvtIJBoeRDJJYkkBTOB/R+R7nGdDT38bfAShJQ="; + sha256 = "sha256-uEgzvhlHHpXyvi3Djfwg3GmYeZq+r48m7OJFIDARpe4="; }; nativeBuildInputs = [ extra-cmake-modules kdoctools ]; diff --git a/pkgs/applications/science/astronomy/siril/default.nix b/pkgs/applications/science/astronomy/siril/default.nix index db0411f1337..255927d893d 100644 --- a/pkgs/applications/science/astronomy/siril/default.nix +++ b/pkgs/applications/science/astronomy/siril/default.nix @@ -1,4 +1,4 @@ -{ lib, stdenv, fetchFromGitLab, pkg-config, meson, ninja +{ lib, stdenv, fetchFromGitLab, fetchpatch, pkg-config, meson, ninja, cmake , git, criterion, gtk3, libconfig, gnuplot, opencv, json-glib , fftwFloat, cfitsio, gsl, exiv2, librtprocess, wcslib, ffmpeg , libraw, libtiff, libpng, libjpeg, libheif, ffms, wrapGAppsHook @@ -6,17 +6,25 @@ stdenv.mkDerivation rec { pname = "siril"; - version = "1.0.6"; + version = "1.2.0"; src = fetchFromGitLab { owner = "free-astro"; - repo = pname; + repo = "siril"; rev = version; - sha256 = "sha256-KFCA3fUMVFHmh1BdKed5/dkq0EeYcmoWec97WX9ZHUc="; + hash = "sha256-lCoFQ7z6cZbyNPEm5s40DNdvTwFonHK3KCd8RniqQWs="; }; + patches = [ + (fetchpatch { + name = "siril-1.2-exiv2-0.28.patch"; + url = "https://gitweb.gentoo.org/repo/gentoo.git/plain/sci-astronomy/siril/files/siril-1.2-exiv2-0.28.patch?id=002882203ad6a2b08ce035a18b95844a9f4b85d0"; + hash = "sha256-R1yslW6hzvJHKo0/IqBxkCuqcX6VrdRSz68gpAExxVE="; + }) + ]; + nativeBuildInputs = [ - meson ninja pkg-config git criterion wrapGAppsHook + meson ninja cmake pkg-config git criterion wrapGAppsHook ]; buildInputs = [ @@ -26,6 +34,7 @@ stdenv.mkDerivation rec { # Necessary because project uses default build dir for flatpaks/snaps dontUseMesonConfigure = true; + dontUseCmakeConfigure = true; configureScript = '' ${meson}/bin/meson --buildtype release nixbld . diff --git a/pkgs/applications/science/astronomy/stellarium/default.nix b/pkgs/applications/science/astronomy/stellarium/default.nix index e2e1cda4c25..3b61c8dac2b 100644 --- a/pkgs/applications/science/astronomy/stellarium/default.nix +++ b/pkgs/applications/science/astronomy/stellarium/default.nix @@ -22,13 +22,13 @@ stdenv.mkDerivation rec { pname = "stellarium"; - version = "23.2"; + version = "23.3"; src = fetchFromGitHub { owner = "Stellarium"; repo = "stellarium"; rev = "v${version}"; - hash = "sha256-8Iheb/9wjf0u10ZQRkLMLNN2s7P++Fqcr26iatiKcTo="; + hash = "sha256-bYvGmYu9jMHk2IUICz2kCVh56Ymz8JHqurdWV+xEdJY="; }; patches = [ @@ -70,7 +70,9 @@ stdenv.mkDerivation rec { qtwayland ]; - preConfigure = lib.optionalString stdenv.isDarwin '' + preConfigure = '' + export SOURCE_DATE_EPOCH=$(date -d 20${lib.versions.major version}0101 +%s) + '' + lib.optionalString stdenv.isDarwin '' export LC_ALL=en_US.UTF-8 ''; @@ -92,6 +94,6 @@ stdenv.mkDerivation rec { homepage = "https://stellarium.org/"; license = licenses.gpl2Plus; platforms = platforms.unix; - maintainers = with maintainers; [ ]; + maintainers = with maintainers; [ kilianar ]; }; } diff --git a/pkgs/applications/science/biology/bedtools/default.nix b/pkgs/applications/science/biology/bedtools/default.nix index 92cb420139d..76780298120 100644 --- a/pkgs/applications/science/biology/bedtools/default.nix +++ b/pkgs/applications/science/biology/bedtools/default.nix @@ -2,13 +2,13 @@ stdenv.mkDerivation rec { pname = "bedtools"; - version = "2.31.0"; + version = "2.31.1"; src = fetchFromGitHub { owner = "arq5x"; repo = "bedtools2"; rev = "v${version}"; - sha256 = "sha256-LBD3z0+zGbQJ67oyPRFPgbiMY9EP17vSk1EKz3DrkEc="; + sha256 = "sha256-rrk+FSv1bGL0D1lrIOsQu2AT7cw2T4lkDiCnzil5fpg="; }; strictDeps = true; diff --git a/pkgs/applications/science/biology/bioawk/default.nix b/pkgs/applications/science/biology/bioawk/default.nix new file mode 100644 index 00000000000..cfbb1a551fa --- /dev/null +++ b/pkgs/applications/science/biology/bioawk/default.nix @@ -0,0 +1,50 @@ +{ lib +, stdenv +, fetchFromGitHub +, installShellFiles +, bison +, zlib +}: + +stdenv.mkDerivation { + pname = "bioawk"; + version = "unstable-2017-09-11"; + + src = fetchFromGitHub { + owner = "lh3"; + repo = "bioawk"; + rev = "fd40150b7c557da45e781a999d372abbc634cc21"; + hash = "sha256-WWgz96DPP83J45isWkMbgEvOlibq6WefK//ImV6+AU0="; + }; + + nativeBuildInputs = [ + bison + installShellFiles + ]; + + buildInputs = [ + zlib + ]; + + buildFlags = [ + "CC=${stdenv.cc.targetPrefix}cc" + ]; + + installPhase = '' + runHook preInstall + + install -Dm755 bioawk -t $out/bin + mv awk.1 bioawk.1 + installManPage bioawk.1 + + runHook postInstall + ''; + + meta = with lib; { + description = "BWK awk modified for biological data"; + homepage = "https://github.com/lh3/bioawk"; + license = licenses.hpnd; + maintainers = with maintainers; [ natsukium ]; + platforms = platforms.unix; + }; +} diff --git a/pkgs/applications/science/biology/blast/bin.nix b/pkgs/applications/science/biology/blast/bin.nix index daae9c09614..48537a568e4 100644 --- a/pkgs/applications/science/biology/blast/bin.nix +++ b/pkgs/applications/science/biology/blast/bin.nix @@ -13,20 +13,20 @@ }: let pname = "blast-bin"; - version = "2.13.0"; + version = "2.14.1"; srcs = rec { x86_64-linux = fetchurl { url = "https://ftp.ncbi.nlm.nih.gov/blast/executables/blast+/${version}/ncbi-blast-${version}+-x64-linux.tar.gz"; - hash = "sha256-QPK3OdT++GoNI1NHyEpu2/hB2hqHYPQ/vNXFAVCwVEc="; + hash = "sha256-OO8MNOk6k0J9FlAGyCOhP+hirEIT6lL+rIInB8dQWEU="; }; aarch64-linux = fetchurl { - url = "https://ftp.ncbi.nlm.nih.gov/blast/executables/blast+/${version}/ncbi-blast-${version}+-x64-arm-linux.tar.gz"; - hash = "sha256-vY8K66k7KunpBUjFsJTTb+ur5n1XmU0/mYxhZsi9ycs="; + url = "https://ftp.ncbi.nlm.nih.gov/blast/executables/blast+/${version}/ncbi-blast-${version}+-aarch64-linux.tar.gz"; + hash = "sha256-JlOyoxZQBbvUcHIMv5muTuGQgrh2uom3rzDurhHQ+FM="; }; x86_64-darwin = fetchurl { url = "https://ftp.ncbi.nlm.nih.gov/blast/executables/blast+/${version}/ncbi-blast-${version}+-x64-macosx.tar.gz"; - hash = "sha256-Y0JlOUl9Ego6LTxTCNny3P5c1H3fApPXQm7Z6Zhq9RA="; + hash = "sha256-eMfuwMCD6VlDgeshLslDhYBBp0YOpL+6q/zSchR0bAs="; }; aarch64-darwin = x86_64-darwin; }; @@ -55,6 +55,7 @@ stdenv.mkDerivation { meta = with lib; { inherit (blast.meta) description homepage license; platforms = [ "x86_64-linux" "aarch64-linux" "x86_64-darwin" "aarch64-darwin" ]; + sourceProvenance = with sourceTypes; [ binaryNativeCode ]; maintainers = with maintainers; [ natsukium ]; }; } diff --git a/pkgs/applications/science/biology/bowtie2/default.nix b/pkgs/applications/science/biology/bowtie2/default.nix index 954b704be0c..356e90555f8 100644 --- a/pkgs/applications/science/biology/bowtie2/default.nix +++ b/pkgs/applications/science/biology/bowtie2/default.nix @@ -1,26 +1,62 @@ -{ lib, stdenv, fetchFromGitHub, cmake, tbb, zlib, python3, perl }: +{ lib +, stdenv +, fetchFromGitHub +, cmake +, perl +, python3 +, tbb +, zlib +, runCommand +, bowtie2 +}: -stdenv.mkDerivation rec { +stdenv.mkDerivation (finalAttrs: { pname = "bowtie2"; - version = "2.5.1"; + version = "2.5.2"; src = fetchFromGitHub { owner = "BenLangmead"; - repo = pname; - rev = "v${version}"; - sha256 = "sha256-HaiZmWU6akHXJVWBmCvkG2E61NDrAP7UIxx9DNCEZqE="; + repo = "bowtie2"; + rev = "refs/tags/v${finalAttrs.version}"; + fetchSubmodules = true; + hash = "sha256-rWeopeYuCk9ZhJX2SFCcxZWcjXjjTiVRiwkzLQcIgd0="; }; + # because of this flag, gcc on aarch64 cannot find the Threads + # Could NOT find Threads (missing: Threads_FOUND) + # TODO: check with other distros and report upstream + postPatch = '' + substituteInPlace CMakeLists.txt \ + --replace "-m64" "" + ''; + nativeBuildInputs = [ cmake ]; buildInputs = [ tbb zlib python3 perl ]; + cmakeFlags = lib.optional (!stdenv.hostPlatform.isx86) ["-DCMAKE_CXX_FLAGS=-I${finalAttrs.src}/third_party"]; + + # ctest fails because of missing dependencies between tests + doCheck = false; + + passthru.tests = { + ctest = runCommand "${finalAttrs.pname}-test" { } '' + mkdir $out + ${lib.getExe bowtie2} -x ${finalAttrs.src}/example/index/lambda_virus ${finalAttrs.src}/example/reads/longreads.fq -u 10 + ${bowtie2}/bin/bowtie2-build-s -c GGGCGGCGACCTCGCGGGTTTTCGCTA $out/small + ${bowtie2}/bin/bowtie2-inspect-s $out/small + ${bowtie2}/bin/bowtie2-build-l -c GGGCGGCGACCTCGCGGGTTTTCGCTA $out/large + ${bowtie2}/bin/bowtie2-inspect-l $out/large + ''; + }; + meta = with lib; { description = "An ultrafast and memory-efficient tool for aligning sequencing reads to long reference sequences"; - license = licenses.gpl3; + license = licenses.gpl3Plus; homepage = "http://bowtie-bio.sf.net/bowtie2"; + changelog = "https://github.com/BenLangmead/bowtie2/releases/tag/${finalAttrs.src.rev}"; maintainers = with maintainers; [ rybern ]; platforms = platforms.all; - broken = stdenv.isAarch64; # only x86 is supported + mainProgram = "bowtie2"; }; -} +}) diff --git a/pkgs/applications/science/biology/deeptools/default.nix b/pkgs/applications/science/biology/deeptools/default.nix index eaf0b593272..a199e41d50a 100644 --- a/pkgs/applications/science/biology/deeptools/default.nix +++ b/pkgs/applications/science/biology/deeptools/default.nix @@ -2,15 +2,17 @@ with python.pkgs; buildPythonApplication rec { pname = "deepTools"; - version = "3.5.1"; + version = "3.5.4"; src = fetchFromGitHub { owner = "deeptools"; repo = "deepTools"; rev = version; - sha256 = "07v8vb2x4b0mgw0mvcj91vj1fqbcwizwsniysl2cvmv93gad8gbp"; + sha256 = "sha256-A8YdlMptmJyxWW0EYLjXFIWjIO/mttEC7VYdlCe9MaI="; }; + format = "pyproject"; + propagatedBuildInputs = [ numpy numpydoc @@ -21,9 +23,10 @@ buildPythonApplication rec { matplotlib plotly deeptoolsintervals + importlib-metadata ]; - nativeCheckInputs = [ nose ]; + nativeCheckInputs = [ pytest ]; meta = with lib; { homepage = "https://deeptools.readthedocs.io/en/develop"; @@ -36,7 +39,7 @@ buildPythonApplication rec { publication-ready visualizations to identify enrichments and for functional annotations of the genome. ''; - license = licenses.gpl3; + license = with licenses; [ mit bsd3 ]; maintainers = with maintainers; [ scalavision ]; }; } diff --git a/pkgs/applications/science/biology/delly/default.nix b/pkgs/applications/science/biology/delly/default.nix index 92eda1d1dd1..52e2980980a 100644 --- a/pkgs/applications/science/biology/delly/default.nix +++ b/pkgs/applications/science/biology/delly/default.nix @@ -13,13 +13,13 @@ stdenv.mkDerivation (finalAttrs: { pname = "delly"; - version = "1.1.6"; + version = "1.1.8"; src = fetchFromGitHub { owner = "dellytools"; repo = "delly"; rev = "v${finalAttrs.version}"; - hash = "sha256-/I//7MhsC/CcBeIJblzbjXp/yOSBm83KWJsrYpl6UJk="; + hash = "sha256-IxZPbcM52E1bzy6msGmka6Ykgc+OLWTMhWBCn0E4mFI="; }; buildInputs = [ diff --git a/pkgs/applications/science/biology/dssp/default.nix b/pkgs/applications/science/biology/dssp/default.nix index 1281643fe79..febfde548fd 100644 --- a/pkgs/applications/science/biology/dssp/default.nix +++ b/pkgs/applications/science/biology/dssp/default.nix @@ -1,31 +1,41 @@ { lib , stdenv , cmake +, eigen , fetchFromGitHub +, fetchpatch , libcifpp , libmcfp , zlib }: let libcifpp' = libcifpp.overrideAttrs (oldAttrs: { - # dssp 4.3.1 requires specific version "5.1.0" of libcifpp - version = "5.1.0"; + # dssp 4.4.3 requires specific version "5.2.0" of libcifpp + version = "5.2.0"; src = fetchFromGitHub { inherit (oldAttrs.src) owner repo rev; - hash = "sha256-PUsi4T6huSqwaa6RnBP1Vj+0a1ePrvrHD0641Lkkc5s="; + hash = "sha256-Sj10j6HxUoUvQ66cd2B8CO7CVBRd7w9CTovxkwPDOvs="; }; + patches = [ + (fetchpatch { + # https://github.com/PDB-REDO/libcifpp/issues/51 + name = "fix-build-on-darwin.patch"; + url = "https://github.com/PDB-REDO/libcifpp/commit/641f06a7e7c0dc54af242b373820f2398f59e7ac.patch"; + hash = "sha256-eWNfp9nA/+2J6xjZR6Tj+5OM3L5MxdfRi0nBzyaqvS0="; + }) + ]; }); in stdenv.mkDerivation (finalAttrs: { pname = "dssp"; - version = "4.4.2"; + version = "4.4.4.1"; src = fetchFromGitHub { owner = "PDB-REDO"; repo = "dssp"; rev = "refs/tags/v${finalAttrs.version}"; - hash = "sha256-Gic/rE/G24P5g4Uhf2lcvVa6i/4KGQzCpK4KlpjXcS0="; + hash = "sha256-sy6GBCnTGRD1YP00dKIolkr1RMboLGcd0f4kU8gCOnA="; }; nativeBuildInputs = [ @@ -33,6 +43,7 @@ stdenv.mkDerivation (finalAttrs: { ]; buildInputs = [ + eigen libcifpp' libmcfp zlib diff --git a/pkgs/applications/science/biology/flywheel-cli/default.nix b/pkgs/applications/science/biology/flywheel-cli/default.nix index 7d74b51f606..254a3c011d2 100644 --- a/pkgs/applications/science/biology/flywheel-cli/default.nix +++ b/pkgs/applications/science/biology/flywheel-cli/default.nix @@ -5,7 +5,7 @@ }: let - inherit (stdenv.targetPlatform) system; + inherit (stdenv.hostPlatform) system; throwSystem = throw "Unsupported system: ${system}"; os = { diff --git a/pkgs/applications/science/biology/kssd/default.nix b/pkgs/applications/science/biology/kssd/default.nix index 34d997252f5..8f60b8b991e 100644 --- a/pkgs/applications/science/biology/kssd/default.nix +++ b/pkgs/applications/science/biology/kssd/default.nix @@ -1,38 +1,57 @@ -{ lib, stdenv, fetchFromGitHub, fetchpatch, zlib, automake, autoconf, libtool }: +{ lib +, stdenv +, fetchFromGitHub +, fetchpatch +, zlib +, kssd +, runCommand +}: -stdenv.mkDerivation rec { +stdenv.mkDerivation (finalAttrs: { pname = "kssd"; - version = "1.1"; + version = "2.21"; src = fetchFromGitHub { owner = "yhg926"; repo = "public_kssd"; - rev = "v${version}"; - sha256 = "sha256-8jzYqo9LXF66pQ1EIusm+gba2VbTYpJz2K3NVlA3QxY="; + rev = "v${finalAttrs.version}"; + hash = "sha256-D/s1jL2oKE0rSdRMVljskYFsw5UPOv1L95Of+K+e17w="; }; patches = [ - # Pull upstream patch for -fno-common toolchain support: - # https://github.com/yhg926/public_kssd/pull/9 + # https://github.com/yhg926/public_kssd/pull/11 (fetchpatch { - name = "fno-common.patch"; - url = "https://github.com/yhg926/public_kssd/commit/cdd1e8aae256146f5913a3b4c723b638d53bdf27.patch"; - sha256 = "sha256-HhaTRqPfKR+ouh0PwEH6u22pbuqbX2OypRzw8BXm0W4="; + name = "allocate-enough-memory.patch"; + url = "https://github.com/yhg926/public_kssd/commit/b1e66bbcc04687bc3201301cd742a0b26a87cb5d.patch"; + hash = "sha256-yFyJetpsGKeu+H6Oxrmn5ea4ESVtblb3YJDja4JEAEM="; }) ]; - nativeBuildInputs = [ autoconf automake ]; - buildInputs = [ zlib libtool ]; + buildInputs = [ zlib ]; installPhase = '' - install -vD kssd $out/bin/kssd + runHook preInstall + + install -vD kssd $out/bin/kssd + + runHook postInstall ''; + passthru.tests = { + simple = runCommand "${finalAttrs.pname}-test" { } '' + mkdir $out + ${lib.getExe kssd} dist -L ${kssd.src}/shuf_file/L3K10.shuf -r ${kssd.src}/test_fna/seqs1 -o $out/reference + ${lib.getExe kssd} dist -L ${kssd.src}/shuf_file/L3K10.shuf -o $out/query ${kssd.src}/test_fna/seqs2 + ${lib.getExe kssd} dist -r $out/reference -o $out/distout $out/query + ''; + }; + meta = with lib; { description = "K-mer substring space decomposition"; license = licenses.asl20; homepage = "https://github.com/yhg926/public_kssd"; maintainers = with maintainers; [ unode ]; - platforms = [ "x86_64-linux" ]; + platforms = platforms.linux; + mainProgram = "kssd"; }; -} +}) diff --git a/pkgs/applications/science/biology/last/default.nix b/pkgs/applications/science/biology/last/default.nix index 8ec08f22b7d..7cf1560d249 100644 --- a/pkgs/applications/science/biology/last/default.nix +++ b/pkgs/applications/science/biology/last/default.nix @@ -9,13 +9,13 @@ stdenv.mkDerivation rec { pname = "last"; - version = "1471"; + version = "1499"; src = fetchFromGitLab { owner = "mcfrith"; repo = "last"; rev = "refs/tags/${version}"; - hash = "sha256-HQ2C7SFfJS6TOJZUm6szhu+hMm41BnH8A7DZE5yh9fM="; + hash = "sha256-uofXtGGDloM1FxW0PYKKwfDOPlAJiapGVKwd1clFzp8="; }; nativeBuildInputs = [ diff --git a/pkgs/applications/science/biology/mmseqs2/default.nix b/pkgs/applications/science/biology/mmseqs2/default.nix index 253f4a43a81..3e39fcb2918 100644 --- a/pkgs/applications/science/biology/mmseqs2/default.nix +++ b/pkgs/applications/science/biology/mmseqs2/default.nix @@ -16,13 +16,13 @@ stdenv.mkDerivation rec { pname = "mmseqs2"; - version = "14-7e284"; + version = "15-6f452"; src = fetchFromGitHub { owner = "soedinglab"; repo = pname; rev = version; - sha256 = "sha256-pVryZGblgMEqJl5M20CHxav269yGY6Y4ci+Gxt6SHOU="; + sha256 = "sha256-L+zOWrGkCLz/wqpBuji8H4/93sDFpcfnDOE8FHq1j84="; }; nativeBuildInputs = [ cmake xxd perl installShellFiles ]; diff --git a/pkgs/applications/science/biology/nest/default.nix b/pkgs/applications/science/biology/nest/default.nix index 90fa6981247..5f0ad540f69 100644 --- a/pkgs/applications/science/biology/nest/default.nix +++ b/pkgs/applications/science/biology/nest/default.nix @@ -20,13 +20,13 @@ stdenv.mkDerivation rec { pname = "nest"; - version = "3.5"; + version = "3.6"; src = fetchFromGitHub { owner = "nest"; repo = "nest-simulator"; rev = "v${version}"; - hash = "sha256-PPUIXlU6noJRAa/twNSKVxPgIvbWl0OillEJRDzt+4s="; + hash = "sha256-sXtF4JmHYoLp0t3o4KF6R2E0qLnKrzSPMXOxVJAm+sU="; }; postPatch = '' diff --git a/pkgs/applications/science/biology/neuron/default.nix b/pkgs/applications/science/biology/neuron/default.nix index 5b08fbfd670..6e5e4feb16f 100644 --- a/pkgs/applications/science/biology/neuron/default.nix +++ b/pkgs/applications/science/biology/neuron/default.nix @@ -21,7 +21,7 @@ stdenv.mkDerivation rec { pname = "neuron"; - version = "8.2.2"; + version = "8.2.3"; # format is for pythonModule conversion format = "other"; @@ -83,7 +83,7 @@ stdenv.mkDerivation rec { src = fetchurl { url = "https://github.com/neuronsimulator/nrn/releases/download/${version}/full-src-package-${version}.tar.gz"; - sha256 = "sha256-orGeBxu3pu4AyAW5P1EGJv8G0dOUZcSOjpUaloqicZU="; + sha256 = "sha256-k8+71BRfh+a73sZho6v0QFRxVmrfx6jqrgaqammdtDI="; }; meta = with lib; { diff --git a/pkgs/applications/science/biology/picard-tools/default.nix b/pkgs/applications/science/biology/picard-tools/default.nix index e0555055c1a..880ea77e9d2 100644 --- a/pkgs/applications/science/biology/picard-tools/default.nix +++ b/pkgs/applications/science/biology/picard-tools/default.nix @@ -2,11 +2,11 @@ stdenv.mkDerivation rec { pname = "picard-tools"; - version = "3.1.0"; + version = "3.1.1"; src = fetchurl { url = "https://github.com/broadinstitute/picard/releases/download/${version}/picard.jar"; - sha256 = "sha256-6nnKYnml6BjLb6aKNHbd55nH6gP/5Somo8poxx7yhVk="; + sha256 = "sha256-FcefUf0KwAEEn53XubrB2991ncsCMKicf20fJG6LurQ="; }; nativeBuildInputs = [ makeWrapper ]; diff --git a/pkgs/applications/science/biology/poretools/default.nix b/pkgs/applications/science/biology/poretools/default.nix index efbedf9a121..efbedf9a121 100755..100644 --- a/pkgs/applications/science/biology/poretools/default.nix +++ b/pkgs/applications/science/biology/poretools/default.nix diff --git a/pkgs/applications/science/biology/quast/default.nix b/pkgs/applications/science/biology/quast/default.nix index e5ee4b53089..f280f81fae8 100644 --- a/pkgs/applications/science/biology/quast/default.nix +++ b/pkgs/applications/science/biology/quast/default.nix @@ -27,7 +27,7 @@ pythonPackages.buildPythonApplication rec { --replace "/bin/bash" "${bash}/bin/bash" mkdir -p "$out/${python.sitePackages}" export PYTHONPATH="$out/${python.sitePackages}:$PYTHONPATH" - ${python.pythonForBuild.interpreter} setup.py install \ + ${python.pythonOnBuildForHost.interpreter} setup.py install \ --install-lib=$out/${python.sitePackages} \ --prefix="$out" ''; diff --git a/pkgs/applications/science/biology/raxml/default.nix b/pkgs/applications/science/biology/raxml/default.nix index d02d4726629..0cc20b06350 100644 --- a/pkgs/applications/science/biology/raxml/default.nix +++ b/pkgs/applications/science/biology/raxml/default.nix @@ -6,13 +6,13 @@ stdenv.mkDerivation rec { pname = "RAxML${lib.optionalString useMpi "-mpi"}"; - version = "8.2.12"; + version = "8.2.13"; src = fetchFromGitHub { owner = "stamatak"; repo = "standard-RAxML"; rev = "v${version}"; - sha256 = "1jqjzhch0rips0vp04prvb8vmc20c5pdmsqn8knadcf91yy859fh"; + sha256 = "sha256-w+Eqi0GhVira1H6ZnMNeZGBMzDjiGT7JSFpQEVXONyk="; }; buildInputs = lib.optionals useMpi [ mpi ]; diff --git a/pkgs/applications/science/biology/sortmerna/default.nix b/pkgs/applications/science/biology/sortmerna/default.nix index 6884e1955f7..a529867aaa7 100644 --- a/pkgs/applications/science/biology/sortmerna/default.nix +++ b/pkgs/applications/science/biology/sortmerna/default.nix @@ -15,7 +15,6 @@ stdenv.mkDerivation rec { buildInputs = [ zlib rocksdb rapidjson ]; cmakeFlags = [ - "-DCMAKE_BUILD_TYPE=Release" "-DPORTABLE=off" "-DRAPIDJSON_HOME=${rapidjson}" "-DROCKSDB_HOME=${rocksdb}" diff --git a/pkgs/applications/science/biology/stacks/default.nix b/pkgs/applications/science/biology/stacks/default.nix index 04ef7c2e062..0a18c5f40fd 100644 --- a/pkgs/applications/science/biology/stacks/default.nix +++ b/pkgs/applications/science/biology/stacks/default.nix @@ -2,10 +2,10 @@ stdenv.mkDerivation rec { pname = "stacks"; - version = "2.62"; + version = "2.65"; src = fetchurl { url = "http://catchenlab.life.illinois.edu/stacks/source/${pname}-${version}.tar.gz"; - sha256 = "sha256-7uhQVLC/AEPAPUdm3+vABoIwG4uhNy/EngjsrZjT0Ts="; + sha256 = "sha256-/9a9PWKVq5yJzEUfOF03zR1Hp3AZw9MF8xICoriV4uo="; }; buildInputs = [ zlib ]; @@ -15,5 +15,6 @@ stdenv.mkDerivation rec { homepage = "http://catchenlab.life.illinois.edu/stacks/"; maintainers = [ lib.maintainers.bzizou ]; license = lib.licenses.gpl3Plus; + platforms = lib.platforms.linux; }; } diff --git a/pkgs/applications/science/biology/trimal/default.nix b/pkgs/applications/science/biology/trimal/default.nix index b27a63a2135..b27a63a2135 100755..100644 --- a/pkgs/applications/science/biology/trimal/default.nix +++ b/pkgs/applications/science/biology/trimal/default.nix diff --git a/pkgs/applications/science/biology/truvari/default.nix b/pkgs/applications/science/biology/truvari/default.nix index e626af56278..946f4be6063 100644 --- a/pkgs/applications/science/biology/truvari/default.nix +++ b/pkgs/applications/science/biology/truvari/default.nix @@ -1,6 +1,5 @@ { lib , fetchFromGitHub -, fetchpatch , python3Packages , runtimeShell , bcftools @@ -16,37 +15,28 @@ let }; in python3Packages.buildPythonApplication rec { pname = "truvari"; - version = "4.0.0"; + version = "4.1.0"; + pyproject = true; src = fetchFromGitHub { owner = "ACEnglish"; repo = "truvari"; rev = "v${version}"; - hash = "sha256-UJNMKEV5m2jFqnWvkVAtymkcE2TjPIXp7JqRZpMSqsE="; + hash = "sha256-HFVAv1TTL/nMjr62tQKhMdwh25P/y4nBGzSbxoJxMmo="; }; - patches = [ - (fetchpatch { - name = "fix-anno-trf-on-darwin.patch"; - url = "https://github.com/ACEnglish/truvari/commit/f9f36305e8eaa88f951562210e3672a4d4f71265.patch"; - hash = "sha256-7O9jTQDCC2b8hUBm0qJQCYMzTC9NFtn/E0dTHSfJALU="; - }) - (fetchpatch { - name = "fix-anno-grm-on-darwin.patch"; - url = "https://github.com/ACEnglish/truvari/commit/31416552008a506204ed4e2add55474f10392357.patch"; - hash = "sha256-42u0ewZU38GCoSfff+XQFv9hEFeO3WlJufTHcl6vkN4="; - }) - ]; - postPatch = '' - substituteInPlace setup.py \ - --replace "rich==" "rich>=" substituteInPlace truvari/utils.py \ --replace "/bin/bash" "${runtimeShell}" patchShebangs repo_utils/test_files ''; + nativeBuildInputs = [ + python3Packages.setuptools + ]; + propagatedBuildInputs = with python3Packages; [ + pywfa rich edlib pysam @@ -83,6 +73,7 @@ in python3Packages.buildPythonApplication rec { meta = with lib; { description = "Structural variant comparison tool for VCFs"; homepage = "https://github.com/ACEnglish/truvari"; + changelog = "https://github.com/ACEnglish/truvari/releases/tag/${src.rev}"; license = licenses.mit; maintainers = with maintainers; [ natsukium scalavision ]; longDescription = '' diff --git a/pkgs/applications/science/biology/vcftools/default.nix b/pkgs/applications/science/biology/vcftools/default.nix index a4ec84d4d50..a4ec84d4d50 100755..100644 --- a/pkgs/applications/science/biology/vcftools/default.nix +++ b/pkgs/applications/science/biology/vcftools/default.nix diff --git a/pkgs/applications/science/chemistry/apbs/default.nix b/pkgs/applications/science/chemistry/apbs/default.nix index 2a892dd5625..228c77ee5c0 100644 --- a/pkgs/applications/science/chemistry/apbs/default.nix +++ b/pkgs/applications/science/chemistry/apbs/default.nix @@ -33,6 +33,10 @@ let "-DBUILD_SUPERLU=OFF" ]; + env = lib.optionalAttrs stdenv.cc.isClang { + NIX_CFLAGS_COMPILE = "-Wno-error=implicit-int"; + }; + buildInputs = [ blas superlu @@ -65,6 +69,10 @@ stdenv.mkDerivation (finalAttrs: { substituteInPlace CMakeLists.txt \ --replace "include(ImportFETK)" "" \ --replace 'import_fetk(''${FETK_VERSION})' "" + + # U was removed in python 3.11 because it had no effect + substituteInPlace tools/manip/inputgen.py \ + --replace '"rU"' '"r"' ''; nativeBuildInputs = [ @@ -88,6 +96,10 @@ stdenv.mkDerivation (finalAttrs: { "-DENABLE_TESTS=1" ]; + env = lib.optionalAttrs stdenv.cc.isClang { + NIX_CFLAGS_COMPILE = "-Wno-error=incompatible-function-pointer-types"; + }; + doCheck = true; meta = with lib; { diff --git a/pkgs/applications/science/chemistry/cp2k/default.nix b/pkgs/applications/science/chemistry/cp2k/default.nix index 29b983cde53..16eabbcbcaa 100644 --- a/pkgs/applications/science/chemistry/cp2k/default.nix +++ b/pkgs/applications/science/chemistry/cp2k/default.nix @@ -1,15 +1,60 @@ -{ lib, stdenv, fetchFromGitHub, mpiCheckPhaseHook, python3, gfortran, blas, lapack -, fftw, libint, libvori, libxc, mpi, gsl, scalapack, openssh, makeWrapper -, libxsmm, spglib, which, pkg-config, plumed, zlib +{ lib +, stdenv +, fetchFromGitHub +, mpiCheckPhaseHook +, python3 +, gfortran +, blas +, lapack +, fftw +, libint +, libvori +, libxc +, mpi +, gsl +, scalapack +, openssh +, makeWrapper +, libxsmm +, spglib +, which +, pkg-config +, plumed +, zlib +, hdf5-fortran +, sirius +, libvdwxc +, spla +, spfft , enableElpa ? false , elpa -} : +, cudaPackages +, rocmPackages +, config +, gpuBackend ? ( + if config.cudaSupport + then "cuda" + else if config.rocmSupport + then "rocm" + else "none" +) +# gpuVersion needs to be set for both CUDA as well as ROCM hardware. +# gpuArch is only required for the ROCM stack. +# Change to a value suitable for your target GPU. +# For AMD values see https://github.com/cp2k/cp2k/blob/master/INSTALL.md#2v-rocmhip-support-for-amd-gpu +# and for Nvidia see https://github.com/cp2k/cp2k/blob/master/INSTALL.md#2i-cuda-optional-improved-performance-on-gpu-systems +, gpuVersion ? "Mi100" +, gpuArch ? "gfx908" +}: + +assert builtins.elem gpuBackend [ "none" "cuda" "rocm" ]; let cp2kVersion = "psmp"; arch = "Linux-x86-64-gfortran"; -in stdenv.mkDerivation rec { +in +stdenv.mkDerivation rec { pname = "cp2k"; version = "2023.2"; @@ -36,7 +81,22 @@ in stdenv.mkDerivation rec { lapack plumed zlib - ] ++ lib.optional enableElpa elpa; + hdf5-fortran + sirius + spla + spfft + libvdwxc + ] + ++ lib.optional enableElpa elpa + ++ lib.optional (gpuBackend == "cuda") cudaPackages.cudatoolkit + ++ lib.optional (gpuBackend == "rocm") [ + rocmPackages.clr + rocmPackages.rocm-core + rocmPackages.hipblas + rocmPackages.hipfft + rocmPackages.rocblas + ] + ; propagatedBuildInputs = [ mpi ]; propagatedUserEnvPkgs = [ mpi ]; @@ -46,7 +106,7 @@ in stdenv.mkDerivation rec { "VERSION=${cp2kVersion}" ]; - doCheck = true; + doCheck = gpuBackend == "none"; enableParallelBuilding = true; @@ -64,25 +124,47 @@ in stdenv.mkDerivation rec { FC = mpif90 LD = mpif90 AR = ar -r + ${lib.strings.optionalString (gpuBackend == "cuda") '' + OFFLOAD_CC = nvcc + OFFLOAD_FLAGS = -O3 -g -w --std=c++11 + OFFLOAD_TARGET = cuda + GPUVER = ${gpuVersion} + CXX = mpicxx + CXXFLAGS = -std=c++11 -fopenmp + ''} + ${lib.strings.optionalString (gpuBackend == "rocm") '' + GPUVER = ${gpuVersion} + OFFLOAD_CC = hipcc + OFFLOAD_FLAGS = -fopenmp -m64 -pthread -fPIC -D__GRID_HIP -O2 --offload-arch=${gpuArch} --rocm-path=${rocmPackages.rocm-core} + OFFLOAD_TARGET = hip + CXX = mpicxx + CXXFLAGS = -std=c++11 -fopenmp -D__HIP_PLATFORM_AMD__ + ''} DFLAGS = -D__FFTW3 -D__LIBXC -D__LIBINT -D__parallel -D__SCALAPACK \ -D__MPI_VERSION=3 -D__F2008 -D__LIBXSMM -D__SPGLIB \ -D__MAX_CONTR=4 -D__LIBVORI ${lib.optionalString enableElpa "-D__ELPA"} \ - -D__PLUMED2 - CFLAGS = -fopenmp + -D__PLUMED2 -D__HDF5 -D__GSL -D__SIRIUS -D__LIBVDWXC -D__SPFFT -D__SPLA \ + ${lib.strings.optionalString (gpuBackend == "cuda") "-D__OFFLOAD_CUDA -D__DBCSR_ACC"} \ + ${lib.strings.optionalString (gpuBackend == "rocm") "-D__OFFLOAD_HIP -D__DBCSR_ACC -D__NO_OFFLOAD_PW"} + CFLAGS = -fopenmp -I${lib.getDev hdf5-fortran}/include -I${lib.getDev gsl}/include FCFLAGS = \$(DFLAGS) -O2 -ffree-form -ffree-line-length-none \ -ftree-vectorize -funroll-loops -msse2 \ -std=f2008 \ -fopenmp -ftree-vectorize -funroll-loops \ - -I${libxc}/include -I${libxsmm}/include \ - -I${libint}/include ${lib.optionalString enableElpa "$(pkg-config --variable=fcflags elpa)"} + -I${lib.getDev libint}/include ${lib.optionalString enableElpa "$(pkg-config --variable=fcflags elpa)"} \ + -I${lib.getDev sirius}/include/sirius \ + -I${lib.getDev libxc}/include -I${lib.getDev libxsmm}/include \ + -fallow-argument-mismatch LIBS = -lfftw3 -lfftw3_threads \ -lscalapack -lblas -llapack \ -lxcf03 -lxc -lxsmmf -lxsmm -lsymspg \ -lint2 -lstdc++ -lvori \ -lgomp -lpthread -lm \ -fopenmp ${lib.optionalString enableElpa "$(pkg-config --libs elpa)"} \ - -lz -ldl -lstdc++ ${lib.optionalString (mpi.pname == "openmpi") "$(mpicxx --showme:link)"} \ - -lplumed + -lz -ldl ${lib.optionalString (mpi.pname == "openmpi") "$(mpicxx --showme:link)"} \ + -lplumed -lhdf5_fortran -lhdf5_hl -lhdf5 -lgsl -lsirius -lspla -lspfft -lvdwxc \ + ${lib.strings.optionalString (gpuBackend == "cuda") "-lcudart -lnvrtc -lcuda -lcublas"} \ + ${lib.strings.optionalString (gpuBackend == "rocm") "-lamdhip64 -lhipfft -lhipblas -lrocblas"} LDFLAGS = \$(FCFLAGS) \$(LIBS) include ${plumed}/lib/plumed/src/lib/Plumed.inc EOF @@ -106,6 +188,7 @@ in stdenv.mkDerivation rec { mkdir -p $out/bin $out/share/cp2k cp exe/${arch}/* $out/bin + rm $out/bin/*_unittest.* for i in cp2k cp2k_shell graph; do wrapProgram $out/bin/$i.${cp2kVersion} \ diff --git a/pkgs/applications/science/chemistry/gwyddion/default.nix b/pkgs/applications/science/chemistry/gwyddion/default.nix index e5807c6c108..5794d7077af 100644 --- a/pkgs/applications/science/chemistry/gwyddion/default.nix +++ b/pkgs/applications/science/chemistry/gwyddion/default.nix @@ -12,7 +12,7 @@ zlibSupport ? true, zlib, libuniqueSupport ? true, libunique, libpngSupport ? true, libpng, - openglSupport ? !stdenv.isDarwin + openglSupport ? !stdenv.isDarwin, libGL }: let @@ -21,17 +21,17 @@ in stdenv.mkDerivation rec { pname = "gwyddion"; - version = "2.61"; + version = "2.64"; src = fetchurl { url = "mirror://sourceforge/gwyddion/gwyddion-${version}.tar.xz"; - sha256 = "sha256-rDhYVMDTH9mSu90HZAX8ap4HF//8fYhW/ozzJdIrUgo="; + sha256 = "sha256-FDL4XDHH6WYF47OsnhxpM7s7YadutiCDjcJKCF8ZlCw="; }; nativeBuildInputs = [ pkg-config file ]; buildInputs = with lib; [ gtk2 fftw ] ++ - optional openglSupport gnome2.gtkglext ++ + optionals openglSupport [ gnome2.gtkglext libGL ] ++ optional openexrSupport openexr ++ optional libXmuSupport xorg.libXmu ++ optional fitsSupport cfitsio ++ diff --git a/pkgs/applications/science/chemistry/jmol/default.nix b/pkgs/applications/science/chemistry/jmol/default.nix index 5745b87a777..0b99c9a849d 100644 --- a/pkgs/applications/science/chemistry/jmol/default.nix +++ b/pkgs/applications/science/chemistry/jmol/default.nix @@ -25,14 +25,14 @@ let }; in stdenv.mkDerivation rec { - version = "16.1.39"; + version = "16.1.43"; pname = "jmol"; src = let baseVersion = "${lib.versions.major version}.${lib.versions.minor version}"; in fetchurl { url = "mirror://sourceforge/jmol/Jmol/Version%20${baseVersion}/Jmol%20${version}/Jmol-${version}-binary.tar.gz"; - hash = "sha256-8M24VXMi7zHkTPNM5zd8nV4J0mXb3/MNIqqxfmlRt9M="; + hash = "sha256-lqHlnAeJKbj2Xs9AeAKqdWMWkmD8xWR7f3+nJsBx2YE="; }; patchPhase = '' diff --git a/pkgs/applications/science/chemistry/marvin/default.nix b/pkgs/applications/science/chemistry/marvin/default.nix index 0f4d76c3f26..5f08bebd47f 100644 --- a/pkgs/applications/science/chemistry/marvin/default.nix +++ b/pkgs/applications/science/chemistry/marvin/default.nix @@ -4,12 +4,12 @@ with lib; stdenv.mkDerivation rec { pname = "marvin"; - version = "23.4.0"; + version = "23.12.0"; src = fetchurl { name = "marvin-${version}.deb"; url = "http://dl.chemaxon.com/marvin/${version}/marvin_linux_${versions.majorMinor version}.deb"; - sha256 = "sha256-+jzGcuAcbXOwsyAL+Hr9Fas2vO2S8ZKSaZeCf/bnl7A="; + hash = "sha256-5ycOteXcdgZaeDl3WQ95H2lD0OnnobCbmnVlfYwVdeI="; }; nativeBuildInputs = [ dpkg makeWrapper ]; diff --git a/pkgs/applications/science/chemistry/mopac/default.nix b/pkgs/applications/science/chemistry/mopac/default.nix index d2b2b558bb7..c0cdc4eff41 100644 --- a/pkgs/applications/science/chemistry/mopac/default.nix +++ b/pkgs/applications/science/chemistry/mopac/default.nix @@ -12,13 +12,13 @@ assert blas.isILP64 == lapack.isILP64; stdenv.mkDerivation rec { pname = "mopac"; - version = "22.0.6"; + version = "22.1.0"; src = fetchFromGitHub { owner = "openmopac"; repo = pname; rev = "v${version}"; - hash = "sha256-j4AP3tki+Ep9Pv+pDg8TwCiJvpF2j5npW3Kpat+7gGg="; + hash = "sha256-4jQ0WCHK07CXWUPj5Z1zSXObKxnitMj+FJQbLDiS2Dc="; }; nativeBuildInputs = [ gfortran cmake ]; diff --git a/pkgs/applications/science/chemistry/nwchem/default.nix b/pkgs/applications/science/chemistry/nwchem/default.nix index 2a17be9f8a9..a7d9462a7fb 100644 --- a/pkgs/applications/science/chemistry/nwchem/default.nix +++ b/pkgs/applications/science/chemistry/nwchem/default.nix @@ -54,13 +54,13 @@ let in stdenv.mkDerivation rec { pname = "nwchem"; - version = "7.2.0"; + version = "7.2.2"; src = fetchFromGitHub { owner = "nwchemgit"; repo = "nwchem"; rev = "v${version}-release"; - hash = "sha256-/biwHOSMGpdnYRGrGlDounKKLVaG2XkBgCmpE0IKR/Y="; + hash = "sha256-BcYRqPaPR24OTRY0MJgBxi46HvUG4uFaY0unZmu5b9k="; }; nativeBuildInputs = [ @@ -106,6 +106,9 @@ stdenv.mkDerivation rec { # Overwrite script, skipping the download echo -e '#!/bin/sh\n cd ga-${versionGA};autoreconf -ivf' > src/tools/get-tools-github + # /usr/bin/env bash fails in sandbox/Makefile setting + substituteInPlace src/config/makefile.h --replace '/usr/bin/env bash' "${stdenv.shell}" + patchShebangs ./ ''; @@ -169,7 +172,6 @@ stdenv.mkDerivation rec { cp -r $NWCHEM_TOP/src/data $out/share/nwchem/ cp -r $NWCHEM_TOP/src/basis/libraries $out/share/nwchem/data cp -r $NWCHEM_TOP/src/nwpw/libraryps $out/share/nwchem/data - cp -r $NWCHEM_TOP/QA $out/share/nwchem wrapProgram $out/bin/nwchem \ --set-default NWCHEM_BASIS_LIBRARY $out/share/nwchem/data/libraries/ @@ -196,7 +198,7 @@ stdenv.mkDerivation rec { runHook preInstallCheck # run a simple water test - mpirun -np 2 $out/bin/nwchem $out/share/nwchem/QA/tests/h2o/h2o.nw > h2o.out + mpirun -np 2 $out/bin/nwchem $NWCHEM_TOP/QA/tests/h2o/h2o.nw > h2o.out grep "Total SCF energy" h2o.out | grep 76.010538 runHook postInstallCheck diff --git a/pkgs/applications/science/chemistry/openmolcas/default.nix b/pkgs/applications/science/chemistry/openmolcas/default.nix index 695d5502b5e..33c77c063bf 100644 --- a/pkgs/applications/science/chemistry/openmolcas/default.nix +++ b/pkgs/applications/science/chemistry/openmolcas/default.nix @@ -8,7 +8,7 @@ , blas-ilp64 , hdf5-cpp , python3 -, texlive +, texliveMinimal , armadillo , libxc , makeWrapper @@ -43,14 +43,14 @@ let in stdenv.mkDerivation { pname = "openmolcas"; - version = "23.06"; + version = "23.10"; src = fetchFromGitLab { owner = "Molcas"; repo = "OpenMolcas"; # The tag keeps moving, fix a hash instead - rev = "1cda3772686cbf99a4af695929a12d563c795ca2"; # 2023-06-12 - sha256 = "sha256-DLRQsRy2jt8V8q2sKmv2hLuKCuMihp/+zcMY/3sg1Fk="; + rev = "c74317e68572d1da82fdce4210b005c2c1b1de53"; # 2023-09-25 + hash = "sha256-wBrASZ6YFsWsu/TreEZ6Q+VxNQwCwMpyPC8AOqmNxos="; }; patches = [ @@ -78,7 +78,7 @@ stdenv.mkDerivation { perl gfortran cmake - texlive.combined.scheme-minimal + texliveMinimal makeWrapper autoPatchelfHook ]; @@ -104,7 +104,7 @@ stdenv.mkDerivation { "-DTOOLS=ON" "-DHDF5=ON" "-DFDE=ON" - "-DEXTERNAL_LIBXC=${libxc}" + "-DEXTERNAL_LIBXC=${lib.getDev libxc}" "-DDMRG=ON" "-DNEVPT2=ON" "-DCMAKE_SKIP_BUILD_RPATH=ON" diff --git a/pkgs/applications/science/chemistry/wxmacmolplt/default.nix b/pkgs/applications/science/chemistry/wxmacmolplt/default.nix index 4e8dbb6f076..13bcf2d1dc6 100644 --- a/pkgs/applications/science/chemistry/wxmacmolplt/default.nix +++ b/pkgs/applications/science/chemistry/wxmacmolplt/default.nix @@ -29,6 +29,8 @@ stdenv.mkDerivation rec { xorg.libX11.dev ]; + configureFlags = [ "LDFLAGS=-lGL" ]; + enableParallelBuilding = true; meta = with lib; { diff --git a/pkgs/applications/science/electronics/dsview/default.nix b/pkgs/applications/science/electronics/dsview/default.nix index 9d643c6eda3..98c35c37e8d 100644 --- a/pkgs/applications/science/electronics/dsview/default.nix +++ b/pkgs/applications/science/electronics/dsview/default.nix @@ -6,13 +6,13 @@ stdenv.mkDerivation rec { pname = "dsview"; - version = "1.3.0"; + version = "1.3.1"; src = fetchFromGitHub { owner = "DreamSourceLab"; repo = "DSView"; rev = "v${version}"; - sha256 = "sha256-wnBVhZ3Ky9PXs48OVvSbD1aAUSEqAwaNLg7Ntim7yFM="; + sha256 = "sha256-LwrlB+Nwq34YjwGmnbUWS3W//ZHr8Do2Wf2te+2oBeI="; }; patches = [ diff --git a/pkgs/applications/science/electronics/geda/default.nix b/pkgs/applications/science/electronics/geda/default.nix index 775bae98133..160928633a3 100644 --- a/pkgs/applications/science/electronics/geda/default.nix +++ b/pkgs/applications/science/electronics/geda/default.nix @@ -1,4 +1,4 @@ -{ lib, stdenv, fetchurl, groff, pkg-config, python2, guile, gtk2, flex, gawk, perl }: +{ lib, stdenv, fetchurl, fetchpatch, autoreconfHook, groff, pkg-config, guile, gtk2, flex, gawk, perl }: stdenv.mkDerivation rec { pname = "geda"; @@ -9,12 +9,20 @@ stdenv.mkDerivation rec { hash = "sha256-6GKrJBUoU4+jvuJzkmH1aAERArYMXjmi8DWGY8BCyKQ="; }; + patches = [ + (fetchpatch { + name = "geda-1.10.2-drop-xorn.patch"; + url = "https://gitweb.gentoo.org/repo/gentoo.git/plain/sci-electronics/geda/files/geda-1.10.2-drop-xorn.patch?id=5589cc7bc6c4f18f75c40725a550b8d76e7f5ca1"; + hash = "sha256-jPQaHjEDwCEfZqDGku+xyIMl5WlWlVcpPv1W6Xf8Grs="; + }) + ]; + configureFlags = [ "--disable-update-xdg-database" "--without-libfam" ]; - nativeBuildInputs = [ groff pkg-config python2 ]; + nativeBuildInputs = [ autoreconfHook groff pkg-config ]; buildInputs = [ guile gtk2 flex gawk perl ]; meta = with lib; { diff --git a/pkgs/applications/science/electronics/horizon-eda/base.nix b/pkgs/applications/science/electronics/horizon-eda/base.nix new file mode 100644 index 00000000000..8ce75a6ce24 --- /dev/null +++ b/pkgs/applications/science/electronics/horizon-eda/base.nix @@ -0,0 +1,58 @@ +{ lib +, cppzmq +, curl +, fetchFromGitHub +, glm +, gtkmm3 +, libarchive +, libepoxy +, libgit2 +, librsvg +, libuuid +, opencascade-occt +, pkg-config +, podofo +, sqlite +}: + +# This base is used in horizon-eda and python3Packages.horizon-eda +rec { + pname = "horizon-eda"; + version = "2.5.0"; + + src = fetchFromGitHub { + owner = "horizon-eda"; + repo = "horizon"; + rev = "v${version}"; + hash = "sha256-UcjbDJR6shyETpanNkRoH8LF8r6gFjsyNHVSCMHKqS8="; + }; + + nativeBuildInputs = [ + pkg-config + ]; + + buildInputs = [ + cppzmq + curl + glm + gtkmm3 + libarchive + libepoxy + libgit2 + librsvg + libuuid + opencascade-occt + podofo + sqlite + ]; + + CASROOT = opencascade-occt; + + meta = with lib; { + description = "A free EDA software to develop printed circuit boards"; + homepage = "https://horizon-eda.org"; + maintainers = with maintainers; [ guserav jue89 ]; + license = licenses.gpl3Plus; + platforms = platforms.linux; + }; +} diff --git a/pkgs/applications/science/electronics/horizon-eda/default.nix b/pkgs/applications/science/electronics/horizon-eda/default.nix index c4c1e798dd5..1fbc92f0611 100644 --- a/pkgs/applications/science/electronics/horizon-eda/default.nix +++ b/pkgs/applications/science/electronics/horizon-eda/default.nix @@ -1,62 +1,33 @@ { stdenv , boost +, callPackage , coreutils -, cppzmq -, curl -, libepoxy -, fetchFromGitHub -, glm -, gtkmm3 -, lib -, libarchive -, libgit2 -, librsvg , libspnav -, libuuid -, opencascade-occt -, pkg-config -, podofo , python3 -, sqlite , wrapGAppsHook }: +let + base = callPackage ./base.nix { }; +in stdenv.mkDerivation rec { - pname = "horizon-eda"; - version = "2.5.0"; + inherit (base) pname version src meta CASROOT; - src = fetchFromGitHub { - owner = "horizon-eda"; - repo = "horizon"; - rev = "v${version}"; - sha256 = "sha256-UcjbDJR6shyETpanNkRoH8LF8r6gFjsyNHVSCMHKqS8="; + # provide base for python module + passthru = { + inherit base; }; - buildInputs = [ - cppzmq - curl - libepoxy - glm - gtkmm3 - libarchive - libgit2 - librsvg + buildInputs = base.buildInputs ++ [ libspnav - libuuid - opencascade-occt - podofo - python3 - sqlite ]; - nativeBuildInputs = [ + nativeBuildInputs = base.nativeBuildInputs ++ [ boost.dev - pkg-config wrapGAppsHook + python3 ]; - CASROOT = opencascade-occt; - installFlags = [ "INSTALL=${coreutils}/bin/install" "DESTDIR=$(out)" @@ -64,12 +35,4 @@ stdenv.mkDerivation rec { ]; enableParallelBuilding = true; - - meta = with lib; { - description = "A free EDA software to develop printed circuit boards"; - homepage = "https://horizon-eda.org"; - maintainers = with maintainers; [ guserav ]; - license = licenses.gpl3; - platforms = platforms.linux; - }; } diff --git a/pkgs/applications/science/electronics/kicad/addons/default.nix b/pkgs/applications/science/electronics/kicad/addons/default.nix new file mode 100644 index 00000000000..5170e7efce3 --- /dev/null +++ b/pkgs/applications/science/electronics/kicad/addons/default.nix @@ -0,0 +1,5 @@ +{ kicad }: +{ + kikit = kicad.callPackage ./kikit.nix { addonName = "kikit"; }; + kikit-library = kicad.callPackage ./kikit.nix { addonName = "kikit-library"; }; +} diff --git a/pkgs/applications/science/electronics/kicad/addons/kikit.nix b/pkgs/applications/science/electronics/kicad/addons/kikit.nix new file mode 100644 index 00000000000..6e5fc5ad967 --- /dev/null +++ b/pkgs/applications/science/electronics/kicad/addons/kikit.nix @@ -0,0 +1,52 @@ +# For building the multiple addons that are in the kikit repo. +{ stdenv +, bc +, kikit +, zip +, python3 +, addonName +, addonPath +}: +let + # This python is only used when building the package, it's not the python + # environment that will ultimately run the code packaged here. The python env defined + # in KiCad will import the python code packaged here when KiCad starts up. + python = python3.withPackages (ps: with ps; [ click ]); + kikit-module = python3.pkgs.toPythonModule (kikit.override { inherit python3; }); + + # The following different addons can be built from the same source. + targetSpecs = { + "kikit" = { + makeTarget = "pcm-kikit"; + resultZip = "pcm-kikit.zip"; + description = "KiCad plugin and a CLI tool to automate several tasks in a standard KiCad workflow"; + }; + "kikit-library" = { + makeTarget = "pcm-lib"; + resultZip = "pcm-kikit-lib.zip"; + description = "KiKit uses these symbols and footprints to annotate your boards (e.g., to place a tab in a panel)."; + }; + }; + targetSpec = targetSpecs.${addonName}; +in +stdenv.mkDerivation { + name = "kicadaddon-${addonName}"; + inherit (kikit-module) src version; + + nativeBuildInputs = [ python bc zip ]; + propagatedBuildInputs = [ kikit-module ]; + + buildPhase = '' + patchShebangs scripts/setJson.py + make ${targetSpec.makeTarget} + ''; + + installPhase = '' + mkdir $out + mv build/${targetSpec.resultZip} $out/${addonPath} + ''; + + meta = kikit-module.meta // { + description = targetSpec.description; + }; +} diff --git a/pkgs/applications/science/electronics/kicad/base.nix b/pkgs/applications/science/electronics/kicad/base.nix index fa9b7703703..a2e5bbe72a5 100644 --- a/pkgs/applications/science/electronics/kicad/base.nix +++ b/pkgs/applications/science/electronics/kicad/base.nix @@ -69,6 +69,8 @@ stdenv.mkDerivation rec { patches = [ # upstream issue 12941 (attempted to upstream, but appreciably unacceptable) ./writable.patch + # https://gitlab.com/kicad/code/kicad/-/issues/15687 + ./runtime_stock_data_path.patch ]; # tagged releases don't have "unknown" @@ -104,7 +106,6 @@ stdenv.mkDerivation rec { "-DKICAD_BUILD_QA_TESTS=OFF" ] ++ optionals (debug) [ - "-DCMAKE_BUILD_TYPE=Debug" "-DKICAD_STDLIB_DEBUG=ON" "-DKICAD_USE_VALGRIND=ON" ] @@ -115,6 +116,8 @@ stdenv.mkDerivation rec { "-DKICAD_SANITIZE_THREADS=ON" ]; + cmakeBuildType = if debug then "Debug" else "Release"; + nativeBuildInputs = [ cmake doxygen diff --git a/pkgs/applications/science/electronics/kicad/default.nix b/pkgs/applications/science/electronics/kicad/default.nix index a49c813036d..c6c66839e4b 100644 --- a/pkgs/applications/science/electronics/kicad/default.nix +++ b/pkgs/applications/science/electronics/kicad/default.nix @@ -1,4 +1,6 @@ { lib, stdenv +, runCommand +, newScope , fetchFromGitLab , gnome , dconf @@ -11,6 +13,8 @@ , callPackages , librsvg , cups +, unzip +, jq , pname ? "kicad" , stable ? true @@ -18,6 +22,7 @@ , libngspice , withScripting ? true , python3 +, addons ? [ ] , debug ? false , sanitizeAddress ? false , sanitizeThreads ? false @@ -27,6 +32,14 @@ , symlinkJoin }: +# `addons`: https://dev-docs.kicad.org/en/addons/ +# +# ```nix +# kicad = pkgs.kicad.override { +# addons = with pkgs.kicadAddons; [ kikit kikit-library ]; +# }; +# ``` + # The `srcs` parameter can be used to override the kicad source code # and all libraries, which are otherwise inaccessible # to overlays since most of the kicad build expression has been @@ -106,6 +119,32 @@ let wxGTK = wxGTK32; python = python3; wxPython = python.pkgs.wxPython_4_2; + addonPath = "addon.zip"; + addonsDrvs = map (pkg: pkg.override { inherit addonPath python3; }) addons; + + addonsJoined = + runCommand "addonsJoined" + { + inherit addonsDrvs; + nativeBuildInputs = [ unzip jq ]; + } '' + mkdir $out + + for pkg in $addonsDrvs; do + unzip $pkg/addon.zip -d unpacked + + folder_name=$(jq .identifier unpacked/metadata.json --raw-output | tr . _) + for d in unpacked/*; do + if [ -d "$d" ]; then + dest=$out/share/kicad/scripting/$(basename $d)/$folder_name + mkdir -p $(dirname $dest) + + mv $d $dest + fi + done + rm -r unpacked + done + ''; inherit (lib) concatStringsSep flatten optionalString optionals; in @@ -113,6 +152,7 @@ stdenv.mkDerivation rec { # Common libraries, referenced during runtime, via the wrapper. passthru.libraries = callPackages ./libraries.nix { inherit libSrc; }; + passthru.callPackage = newScope { inherit addonPath python3; }; base = callPackage ./base.nix { inherit stable baseName; inherit kicadSrc kicadVersion; @@ -131,7 +171,7 @@ stdenv.mkDerivation rec { dontFixup = true; pythonPath = optionals (withScripting) - [ wxPython python.pkgs.six python.pkgs.requests ]; + [ wxPython python.pkgs.six python.pkgs.requests ] ++ addonsDrvs; nativeBuildInputs = [ makeWrapper ] ++ optionals (withScripting) @@ -164,6 +204,17 @@ stdenv.mkDerivation rec { "--set-default KICAD7_SYMBOL_DIR ${symbols}/share/kicad/symbols" "--set-default KICAD7_TEMPLATE_DIR ${template_dir}" ] + ++ optionals (addons != [ ]) ( + let stockDataPath = symlinkJoin { + name = "kicad_stock_data_path"; + paths = [ + "${base}/share/kicad" + "${addonsJoined}/share/kicad" + ]; + }; + in + [ "--set-default NIX_KICAD7_STOCK_DATA_PATH ${stockDataPath}" ] + ) ++ optionals (with3d) [ "--set-default KICAD7_3DMODEL_DIR ${packages3d}/share/kicad/3dmodels" diff --git a/pkgs/applications/science/electronics/kicad/runtime_stock_data_path.patch b/pkgs/applications/science/electronics/kicad/runtime_stock_data_path.patch new file mode 100644 index 00000000000..16f7e493c62 --- /dev/null +++ b/pkgs/applications/science/electronics/kicad/runtime_stock_data_path.patch @@ -0,0 +1,15 @@ +diff --git a/common/paths.cpp b/common/paths.cpp +index a74cdd9..790cc58 100644 +--- a/common/paths.cpp ++++ b/common/paths.cpp +@@ -151,6 +151,10 @@ wxString PATHS::GetStockDataPath( bool aRespectRunFromBuildDir ) + { + wxString path; + ++ if( wxGetEnv( wxT( "NIX_KICAD7_STOCK_DATA_PATH" ), &path ) ) { ++ return path; ++ } ++ + if( aRespectRunFromBuildDir && wxGetEnv( wxT( "KICAD_RUN_FROM_BUILD_DIR" ), nullptr ) ) + { + // Allow debugging from build dir by placing relevant files/folders in the build root diff --git a/pkgs/applications/science/electronics/magic-vlsi/0001-strip-bin-prefix.patch b/pkgs/applications/science/electronics/magic-vlsi/0001-strip-bin-prefix.patch deleted file mode 100644 index 1cef96ea140..00000000000 --- a/pkgs/applications/science/electronics/magic-vlsi/0001-strip-bin-prefix.patch +++ /dev/null @@ -1,10 +0,0 @@ -diff --git a/scripts/makedbh b/scripts/makedbh -index 01e4fa5..d6299c6 100755 ---- a/scripts/makedbh -+++ b/scripts/makedbh -@@ -1,4 +1,4 @@ --#!/bin/csh -f -+#!/usr/bin/env tcsh - # - # makes the "database.h" (1st argument, $1) file from "database.h.in" - # (2nd argument, $2), setting various mask operation definitions diff --git a/pkgs/applications/science/electronics/magic-vlsi/default.nix b/pkgs/applications/science/electronics/magic-vlsi/default.nix index fc68969bd49..c816b356267 100644 --- a/pkgs/applications/science/electronics/magic-vlsi/default.nix +++ b/pkgs/applications/science/electronics/magic-vlsi/default.nix @@ -13,11 +13,11 @@ stdenv.mkDerivation rec { pname = "magic-vlsi"; - version = "8.3.277"; + version = "8.3.447"; src = fetchurl { url = "http://opencircuitdesign.com/magic/archive/magic-${version}.tgz"; - sha256 = "sha256-cS3KaIVwGN/mMfRKjJxzdY6DeNV7tw2fATIHrFBV0fY="; + sha256 = "sha256-t/gJ43VIdBIiozLfqaTy7tJsXK674gWBbW1aPHKEj3U="; }; nativeBuildInputs = [ python3 ]; @@ -46,10 +46,6 @@ stdenv.mkDerivation rec { env.NIX_CFLAGS_COMPILE = "-Wno-implicit-function-declaration"; - patches = [ - ./0001-strip-bin-prefix.patch - ]; - meta = with lib; { description = "VLSI layout tool written in Tcl"; homepage = "http://opencircuitdesign.com/magic/"; diff --git a/pkgs/applications/science/electronics/nvc/default.nix b/pkgs/applications/science/electronics/nvc/default.nix index 94e0741f79a..dc4991bf480 100644 --- a/pkgs/applications/science/electronics/nvc/default.nix +++ b/pkgs/applications/science/electronics/nvc/default.nix @@ -16,13 +16,13 @@ stdenv.mkDerivation rec { pname = "nvc"; - version = "1.10.3"; + version = "1.10.4"; src = fetchFromGitHub { owner = "nickg"; repo = "nvc"; rev = "r${version}"; - hash = "sha256-0KLya2B+gs7aoOvkQdHuJuQtCHLUeSYATToBfIDhm/c="; + hash = "sha256-f4VjSBoJnsGb8MHKegJDlomPG32DuTgFcyv1w0GxKvA="; }; nativeBuildInputs = [ diff --git a/pkgs/applications/science/electronics/openboardview/default.nix b/pkgs/applications/science/electronics/openboardview/default.nix index 715a99cf489..a750001d05d 100644 --- a/pkgs/applications/science/electronics/openboardview/default.nix +++ b/pkgs/applications/science/electronics/openboardview/default.nix @@ -39,7 +39,6 @@ stdenv.mkDerivation rec { ''; cmakeFlags = [ - "-DCMAKE_BUILD_TYPE=Release" "-DGLAD_REPRODUCIBLE=On" ]; diff --git a/pkgs/applications/science/electronics/picoscope/sources.json b/pkgs/applications/science/electronics/picoscope/sources.json index 15a748dc7ce..6b1d81978b9 100644 --- a/pkgs/applications/science/electronics/picoscope/sources.json +++ b/pkgs/applications/science/electronics/picoscope/sources.json @@ -1,69 +1,69 @@ { "x86_64-linux": { "libpicocv": { - "sha256": "feddc1cb9082005e80c4e2c2732ee4c537915c463ea327aa53a642aab95b8691", - "url": "https://labs.picotech.com/rc/picoscope7/debian/pool/main/libp/libpicocv/libpicocv_1.1.33-beta2r167_amd64.deb", - "version": "1.1.33-beta2r167" + "sha256": "c0c5bec33c2c7fdd0f26b035ed942175f87012e33d6764c3abf1da31b5626037", + "url": "https://labs.picotech.com/rc/picoscope7/debian/pool/main/libp/libpicocv/libpicocv_1.1.34-beta2r172_amd64.deb", + "version": "1.1.34-beta2r172" }, "libpicoipp": { - "sha256": "2d749b8fd5dbd811c270e4aa78c5ee9cd33832b90d089ae386b0f85aed2d0204", - "url": "https://labs.picotech.com/rc/picoscope7/debian/pool/main/libp/libpicoipp/libpicoipp_1.4.0-4r136_amd64.deb", - "version": "1.4.0-4r136" + "sha256": "4a84f0af7f4e8cba91fad620eac0cd23c36b2fdda4637904be564286b10ffe1d", + "url": "https://labs.picotech.com/rc/picoscope7/debian/pool/main/libp/libpicoipp/libpicoipp_1.4.0-4r161_amd64.deb", + "version": "1.4.0-4r161" }, "libps2000": { - "sha256": "d306890d1e87651ae83ef00143c8e62b82fae2be39886b6884408751cb910fa4", - "url": "https://labs.picotech.com/rc/picoscope7/debian/pool/main/libp/libps2000/libps2000_3.0.89-3r3163_amd64.deb", - "version": "3.0.89-3r3163" + "sha256": "473b065e79a7414c1e2b8c8468c8d2654333ac28f3a8c33b535626b33c60d2ca", + "url": "https://labs.picotech.com/rc/picoscope7/debian/pool/main/libp/libps2000/libps2000_3.0.127-3r5552_amd64.deb", + "version": "3.0.127-3r5552" }, "libps2000a": { - "sha256": "38391dfbe6c6c04ba5b5c99bd53404d5342e40c9eca703e3d95cbc6302114270", - "url": "https://labs.picotech.com/rc/picoscope7/debian/pool/main/libp/libps2000a/libps2000a_2.1.89-5r3163_amd64.deb", - "version": "2.1.89-5r3163" + "sha256": "8eba0052f9c7ef327710f2fba5aa11bec0c20225b39d77bb7b69cf80055c039c", + "url": "https://labs.picotech.com/rc/picoscope7/debian/pool/main/libp/libps2000a/libps2000a_2.1.127-5r5552_amd64.deb", + "version": "2.1.127-5r5552" }, "libps3000": { - "sha256": "39b4b56a839eb5d7abcf1de2bab472c2de2d8aa5ffc3ba445e99d5aa8178ba07", - "url": "https://labs.picotech.com/rc/picoscope7/debian/pool/main/libp/libps3000/libps3000_4.0.89-3r3163_amd64.deb", - "version": "4.0.89-3r3163" + "sha256": "4e786036b8de0dd0f922aed947f30a53d31bed46b2df5132e8c9480c8a5d93e9", + "url": "https://labs.picotech.com/rc/picoscope7/debian/pool/main/libp/libps3000/libps3000_4.0.127-3r5552_amd64.deb", + "version": "4.0.127-3r5552" }, "libps3000a": { - "sha256": "ea96735b90d02c72c9c7b517413fed0d366ac634100e22467a39c780985669e4", - "url": "https://labs.picotech.com/rc/picoscope7/debian/pool/main/libp/libps3000a/libps3000a_2.1.89-6r3163_amd64.deb", - "version": "2.1.89-6r3163" + "sha256": "d2bb1e5bb151b0953ed30ca5421bb93d05dab898c33cdc89927e943ea991867a", + "url": "https://labs.picotech.com/rc/picoscope7/debian/pool/main/libp/libps3000a/libps3000a_2.1.127-6r5552_amd64.deb", + "version": "2.1.127-6r5552" }, "libps4000": { - "sha256": "7177cd4debf811fa7d7105703a4fc546fe1a79fc3275e3f36326b014c1334f55", - "url": "https://labs.picotech.com/rc/picoscope7/debian/pool/main/libp/libps4000/libps4000_2.1.89-2r3163_amd64.deb", - "version": "2.1.89-2r3163" + "sha256": "4c127e67949835b5ab5c5c8caa55f73c69df354d761aa53d6df99c8f8ac39009", + "url": "https://labs.picotech.com/rc/picoscope7/debian/pool/main/libp/libps4000/libps4000_2.1.127-2r5552_amd64.deb", + "version": "2.1.127-2r5552" }, "libps4000a": { - "sha256": "ebe94d6d9f349e5082dcbed55d059ac77c0129b967467786d1cef3f662ebac99", - "url": "https://labs.picotech.com/rc/picoscope7/debian/pool/main/libp/libps4000a/libps4000a_2.1.89-2r3163_amd64.deb", - "version": "2.1.89-2r3163" + "sha256": "26df82bc946e5bb30d599c4c365247bdbaa01e830d4d00630b46a6abcc1eef04", + "url": "https://labs.picotech.com/rc/picoscope7/debian/pool/main/libp/libps4000a/libps4000a_2.1.127-2r5552_amd64.deb", + "version": "2.1.127-2r5552" }, "libps5000": { - "sha256": "732164658acb4bdfdbf3fc785419ea6a4944ed2892be9dde134b345a976c3318", - "url": "https://labs.picotech.com/rc/picoscope7/debian/pool/main/libp/libps5000/libps5000_2.1.89-3r3163_amd64.deb", - "version": "2.1.89-3r3163" + "sha256": "106ef17862e98c3621f95c377f271c843664f481f84ef918d9eadd013561cd1b", + "url": "https://labs.picotech.com/rc/picoscope7/debian/pool/main/libp/libps5000/libps5000_2.1.127-3r5552_amd64.deb", + "version": "2.1.127-3r5552" }, "libps5000a": { - "sha256": "3438f51c8646e3ac5a479c88aa7a89b3dfcce2090720317b4efb8db538372cdb", - "url": "https://labs.picotech.com/rc/picoscope7/debian/pool/main/libp/libps5000a/libps5000a_2.1.89-5r3163_amd64.deb", - "version": "2.1.89-5r3163" + "sha256": "fe9def134ef9df6654485911f14ece7b2ee3d79113aeee7826dd6e36bb5de3b4", + "url": "https://labs.picotech.com/rc/picoscope7/debian/pool/main/libp/libps5000a/libps5000a_2.1.127-5r5552_amd64.deb", + "version": "2.1.127-5r5552" }, "libps6000": { - "sha256": "fe4165ab0d323728b473347b61439b074486809d673e47f169d0062cf917191c", - "url": "https://labs.picotech.com/rc/picoscope7/debian/pool/main/libp/libps6000/libps6000_2.1.89-6r3163_amd64.deb", - "version": "2.1.89-6r3163" + "sha256": "9b08c5b7fb2d34b0e2e98f2e0452a59105f612cd445a9e45d3cac14d931d18f2", + "url": "https://labs.picotech.com/rc/picoscope7/debian/pool/main/libp/libps6000/libps6000_2.1.127-6r5552_amd64.deb", + "version": "2.1.127-6r5552" }, "libps6000a": { - "sha256": "0552811f92a015ef47b09947631f5f5d8c30b122425de083bea79df88957a9c7", - "url": "https://labs.picotech.com/rc/picoscope7/debian/pool/main/libp/libps6000a/libps6000a_1.0.89-0r3163_amd64.deb", - "version": "1.0.89-0r3163" + "sha256": "2a23ccad72b9be83b87d449b6bb8ded23fd29c85ec9f78a45b6d45b38ccf335b", + "url": "https://labs.picotech.com/rc/picoscope7/debian/pool/main/libp/libps6000a/libps6000a_1.0.127-0r5552_amd64.deb", + "version": "1.0.127-0r5552" }, "picoscope": { - "sha256": "b060edb02bc2de5d10a45d31d4b7f9c767d18511e2f65a1ebdd70cc3e8780262", - "url": "https://labs.picotech.com/rc/picoscope7/debian/pool/main/p/picoscope/picoscope_7.0.100-1r11387_amd64.deb", - "version": "7.0.100-1r11387" + "sha256": "d95f269171da7273b596dae95452789e889f12ef0f15c3baea26dd1b3a8117fc", + "url": "https://labs.picotech.com/rc/picoscope7/debian/pool/main/p/picoscope/picoscope_7.1.17-1r17318_amd64.deb", + "version": "7.1.17-1r17318" } } } diff --git a/pkgs/applications/science/electronics/qucs-s/default.nix b/pkgs/applications/science/electronics/qucs-s/default.nix index 0ce67ec4dbb..593e9d9187b 100644 --- a/pkgs/applications/science/electronics/qucs-s/default.nix +++ b/pkgs/applications/science/electronics/qucs-s/default.nix @@ -18,13 +18,13 @@ stdenv.mkDerivation rec { pname = "qucs-s"; - version = "2.0.0"; + version = "2.1.0"; src = fetchFromGitHub { owner = "ra3xdh"; repo = "qucs_s"; rev = version; - sha256 = "sha256-9/1sgxFqn9d9zlwrzjQosFO3m+2lC83qVcCtzfqY5XY="; + sha256 = "sha256-C7TLOuC0CHredDiWFIAFmOlV8ivX0j4bs3b8IB8FsqE="; }; nativeBuildInputs = [ flex bison wrapQtAppsHook cmake ]; diff --git a/pkgs/applications/science/electronics/verilator/default.nix b/pkgs/applications/science/electronics/verilator/default.nix index 90601651e51..0c2adf0907e 100644 --- a/pkgs/applications/science/electronics/verilator/default.nix +++ b/pkgs/applications/science/electronics/verilator/default.nix @@ -4,13 +4,13 @@ stdenv.mkDerivation rec { pname = "verilator"; - version = "5.012"; + version = "5.018"; src = fetchFromGitHub { owner = pname; repo = pname; rev = "v${version}"; - hash = "sha256-Y6GkIgkauayJmGhOQg2kWjbcxYVIob6InMopv555Lb8="; + hash = "sha256-f06UzNw2MQ5me03EPrVFhkwxKum/GLDzQbDNTBsJMJs="; }; enableParallelBuilding = true; diff --git a/pkgs/applications/science/electronics/verilog/default.nix b/pkgs/applications/science/electronics/verilog/default.nix index 0a93759947d..06e8a94a4c5 100644 --- a/pkgs/applications/science/electronics/verilog/default.nix +++ b/pkgs/applications/science/electronics/verilog/default.nix @@ -44,6 +44,10 @@ stdenv.mkDerivation rec { enableParallelBuilding = true; + env = lib.optionalAttrs stdenv.isDarwin { + NIX_CFLAGS_COMPILE = "-Wno-error=implicit-function-declaration"; + }; + # NOTE(jleightcap): the `make check` target only runs a "Hello, World"-esque sanity check. # the tests in the doInstallCheck phase run a full regression test suite. # however, these tests currently fail upstream on aarch64 diff --git a/pkgs/applications/science/electronics/xschem/default.nix b/pkgs/applications/science/electronics/xschem/default.nix index 456b939c60a..826181139c1 100644 --- a/pkgs/applications/science/electronics/xschem/default.nix +++ b/pkgs/applications/science/electronics/xschem/default.nix @@ -13,13 +13,13 @@ stdenv.mkDerivation rec { pname = "xschem"; - version = "3.1.0"; + version = "3.4.4"; src = fetchFromGitHub { owner = "StefanSchippers"; repo = "xschem"; rev = version; - sha256 = "sha256-SHpESg5mn9lSDOURQusQUsug8Jqin/W5rqkVgmseSgA="; + sha256 = "sha256-1jP1SJeq23XNkOQgcl2X+rBrlka4a04irmfhoKRM1j4="; }; nativeBuildInputs = [ bison flex pkg-config ]; diff --git a/pkgs/applications/science/electronics/xyce/default.nix b/pkgs/applications/science/electronics/xyce/default.nix index aee1d25a04c..663d6e025c5 100644 --- a/pkgs/applications/science/electronics/xyce/default.nix +++ b/pkgs/applications/science/electronics/xyce/default.nix @@ -16,7 +16,7 @@ , trilinos , withMPI ? false # for doc -, texlive +, texliveMedium , pandoc , enableDocs ? true # for tests @@ -81,16 +81,14 @@ stdenv.mkDerivation rec { gfortran libtool_2 ] ++ lib.optionals enableDocs [ - (texlive.combine { - inherit (texlive) - scheme-medium + (texliveMedium.withPackages (ps: with ps; [ koma-script optional framed enumitem multirow - preprint; - }) + preprint + ])) ]; buildInputs = [ diff --git a/pkgs/applications/science/geometry/drgeo/default.nix b/pkgs/applications/science/geometry/drgeo/default.nix deleted file mode 100644 index 0cc8bcb0fb3..00000000000 --- a/pkgs/applications/science/geometry/drgeo/default.nix +++ /dev/null @@ -1,30 +0,0 @@ -{ lib, stdenv, fetchurl, libglade, gtk2, guile, libxml2, perl -, intltool, libtool, pkg-config }: - -stdenv.mkDerivation rec { - pname = "drgeo"; - version = "1.1.0"; - - hardeningDisable = [ "format" ]; - - src = fetchurl { - url = "mirror://sourceforge/ofset/${pname}-${version}.tar.gz"; - sha256 = "05i2czgzhpzi80xxghinvkyqx4ym0gm9f38fz53idjhigiivp4wc"; - }; - patches = [ ./struct.patch ]; - - nativeBuildInputs = [ pkg-config intltool ]; - buildInputs = [libglade gtk2 guile libxml2 - perl libtool ]; - - prebuild = '' - cp drgeo.desktop.in drgeo.desktop - ''; - - meta = with lib; { - description = "Interactive geometry program"; - homepage = "https://sourceforge.net/projects/ofset"; - license = licenses.gpl2; - platforms = platforms.linux; - }; -} diff --git a/pkgs/applications/science/geometry/drgeo/struct.patch b/pkgs/applications/science/geometry/drgeo/struct.patch deleted file mode 100644 index 7364cae5f58..00000000000 --- a/pkgs/applications/science/geometry/drgeo/struct.patch +++ /dev/null @@ -1,68 +0,0 @@ --- drgeo-1.1.0/debian/patches/00list -++ drgeo-1.1.0/debian/patches/00list -@ -7 +7 @@ - -07-fix_ftbfs-gcc-4.5.dpatch -nly in patch2: -nchanged: --- drgeo-1.1.0.orig/debian/patches/07-fix_ftbfs-gcc-4.5.dpatch -++ drgeo-1.1.0/debian/patches/07-fix_ftbfs-gcc-4.5.dpatch -@ -0,0 +1,58 @@ -#! /bin/sh /usr/share/dpatch/dpatch-run -## 07-fix_ftbfs-gcc-4.5.dpatch by Fabrice Coutadeur <fabric...@ubuntu.com> -## -## Description: fix FTBFS with gcc 4.5 with undefined reference to -## `drgeoDialogData' -## Author: Petr Gajdos <pgaj...@suse.cz> -## Origin: https://build.opensuse.org/package/files?package=drgeo&project=openSUSE%3A11.3%3AContrib - -...@dpatch@ -diff -urNad '--exclude=CVS' '--exclude=.svn' '--exclude=.git' '--exclude=.arch' '--exclude=.hg' '--exclude=_darcs' '--exclude=.bzr' drgeo-1.1.0~/geo/drgeo_dialog.cc drgeo-1.1.0/geo/drgeo_dialog.cc ---- drgeo-1.1.0~/geo/drgeo_dialog.cc 2003-10-27 10:17:25.000000000 +0000 -+++ drgeo-1.1.0/geo/drgeo_dialog.cc 2010-11-13 07:26:03.258908003 +0000 -@@ -38,12 +38,7 @@ - // Used in the style dialod callback, I know it's ugly, but so easy - static drgeoFigure *selected_figure; - --struct --{ -- drgeoPoint mouse; -- drgeoFigure *figure; --} --drgeoDialogData; -+DialogData drgeoDialogData; - - - static void drgeo_edit_dialog_cb (GtkWidget * dialog, -diff -urNad '--exclude=CVS' '--exclude=.svn' '--exclude=.git' '--exclude=.arch' '--exclude=.hg' '--exclude=_darcs' '--exclude=.bzr' drgeo-1.1.0~/geo/drgeo_dialog.h drgeo-1.1.0/geo/drgeo_dialog.h ---- drgeo-1.1.0~/geo/drgeo_dialog.h 2003-06-12 22:30:23.000000000 +0000 -+++ drgeo-1.1.0/geo/drgeo_dialog.h 2010-11-13 07:26:03.258908003 +0000 -@@ -34,4 +34,11 @@ - } - - #endif /* __cplusplus */ -+ -+typedef struct -+{ -+ drgeoPoint mouse; -+ drgeoFigure *figure; -+} DialogData; -+ - #endif -diff -urNad '--exclude=CVS' '--exclude=.svn' '--exclude=.git' '--exclude=.arch' '--exclude=.hg' '--exclude=_darcs' '--exclude=.bzr' drgeo-1.1.0~/geo/drgeo_figure.cc drgeo-1.1.0/geo/drgeo_figure.cc ---- drgeo-1.1.0~/geo/drgeo_figure.cc 2005-07-14 07:30:01.000000000 +0000 -+++ drgeo-1.1.0/geo/drgeo_figure.cc 2010-11-13 07:26:03.258908003 +0000 -@@ -48,12 +48,7 @@ - #include "drgeo_dialog.h" - #include "traite.h" - --extern struct --{ -- drgeoPoint mouse; -- drgeoFigure *figure; --} --drgeoDialogData; -+extern DialogData drgeoDialogData; - - typedef struct drgeoSearchValue - { diff --git a/pkgs/applications/science/geometry/gama/default.nix b/pkgs/applications/science/geometry/gama/default.nix index 728cbe62292..790a9b2d216 100644 --- a/pkgs/applications/science/geometry/gama/default.nix +++ b/pkgs/applications/science/geometry/gama/default.nix @@ -1,11 +1,11 @@ { stdenv, fetchurl, lib, expat, octave, libxml2, texinfo, zip }: stdenv.mkDerivation rec { pname = "gama"; - version = "2.25"; + version = "2.26"; src = fetchurl { url = "mirror://gnu/${pname}/${pname}-${version}.tar.gz"; - sha256 = "sha256-1j4fsPQEaftqmrdk6ZPWKSl7ywA/UPN8bdddGVlPxDQ="; + sha256 = "sha256-8zKPPpbp66tD2zMmcv2H5xeCSdDhUk0uYPhqwpGqx9Y="; }; buildInputs = [ expat ]; diff --git a/pkgs/applications/science/logic/abc/default.nix b/pkgs/applications/science/logic/abc/default.nix index 1062582d82c..1685bb7aba3 100644 --- a/pkgs/applications/science/logic/abc/default.nix +++ b/pkgs/applications/science/logic/abc/default.nix @@ -1,32 +1,39 @@ -{ lib, stdenv, fetchFromGitHub -, readline, cmake +{ lib +, stdenv +, fetchFromGitHub +, readline +, cmake }: -stdenv.mkDerivation rec { +stdenv.mkDerivation (finalAttrs: { pname = "abc-verifier"; - version = "unstable-2023-06-28"; + version = "unstable-2023-10-13"; src = fetchFromGitHub { owner = "yosyshq"; repo = "abc"; - rev = "bb64142b07794ee685494564471e67365a093710"; - hash = "sha256-Qkk61Lh84ervtehWskSB9GKh+JPB7mI1IuG32OSZMdg="; + rev = "896e5e7dedf9b9b1459fa019f1fa8aa8101fdf43"; + hash = "sha256-ou+E2lvDEOxXRXNygE/TyVi7quqk+CJHRI+HDI0xljE="; }; nativeBuildInputs = [ cmake ]; buildInputs = [ readline ]; - installPhase = "mkdir -p $out/bin && mv abc $out/bin"; + installPhase = '' + runHook preInstall + install -Dm755 'abc' "$out/bin/abc" + runHook postInstall + ''; # needed by yosys - passthru.rev = src.rev; + passthru.rev = finalAttrs.src.rev; meta = with lib; { description = "A tool for squential logic synthesis and formal verification"; homepage = "https://people.eecs.berkeley.edu/~alanmi/abc"; license = licenses.mit; - maintainers = with maintainers; [ thoughtpolice ]; + maintainers = with maintainers; [ thoughtpolice Luflosi ]; mainProgram = "abc"; platforms = platforms.unix; }; -} +}) diff --git a/pkgs/applications/science/logic/abella/default.nix b/pkgs/applications/science/logic/abella/default.nix index 1d0c72359cf..7e4cfad72ed 100644 --- a/pkgs/applications/science/logic/abella/default.nix +++ b/pkgs/applications/science/logic/abella/default.nix @@ -2,20 +2,21 @@ stdenv.mkDerivation rec { pname = "abella"; - version = "2.0.7"; + version = "2.0.8"; src = fetchurl { url = "http://abella-prover.org/distributions/${pname}-${version}.tar.gz"; - sha256 = "sha256-/eOiebMFHgrurtrSHPlgZO3xmmxBOUmyAzswXZLd3Yc="; + sha256 = "sha256-80b/RUpE3KRY0Qu8eeTxAbk6mwGG6jVTPOP0qFjyj2M="; }; strictDeps = true; - nativeBuildInputs = [ rsync ] ++ (with ocamlPackages; [ ocaml ocamlbuild findlib ]); + nativeBuildInputs = [ rsync ] ++ (with ocamlPackages; [ ocaml dune_3 menhir findlib ]); + buildInputs = with ocamlPackages; [ cmdliner yojson ]; installPhase = '' mkdir -p $out/bin - rsync -av abella $out/bin/ + rsync -av _build/default/src/abella.exe $out/bin/abella mkdir -p $out/share/emacs/site-lisp/abella/ rsync -av emacs/ $out/share/emacs/site-lisp/abella/ diff --git a/pkgs/applications/science/logic/aiger/default.nix b/pkgs/applications/science/logic/aiger/default.nix index 15c45466b13..5b9e8f62aa0 100644 --- a/pkgs/applications/science/logic/aiger/default.nix +++ b/pkgs/applications/science/logic/aiger/default.nix @@ -5,10 +5,15 @@ stdenv.mkDerivation rec { version = "1.9.9"; src = fetchurl { - url = "http://fmv.jku.at/aiger/${pname}-${version}.tar.gz"; + url = "https://fmv.jku.at/aiger/${pname}-${version}.tar.gz"; sha256 = "1ish0dw0nf9gyghxsdhpy1jjiy5wp54c993swp85xp7m6vdx6l0y"; }; + patches = [ + # Fix implicit declaration of `isatty`, which is an error with newer versions of clang. + ./fix-missing-header.patch + ]; + enableParallelBuilding = true; configurePhase = '' @@ -47,7 +52,7 @@ stdenv.mkDerivation rec { meta = { description = "And-Inverter Graph (AIG) utilities"; - homepage = "http://fmv.jku.at/aiger/"; + homepage = "https://fmv.jku.at/aiger/"; license = lib.licenses.mit; maintainers = with lib.maintainers; [ thoughtpolice ]; platforms = lib.platforms.unix; diff --git a/pkgs/applications/science/logic/aiger/fix-missing-header.patch b/pkgs/applications/science/logic/aiger/fix-missing-header.patch new file mode 100644 index 00000000000..5f0101bd7a0 --- /dev/null +++ b/pkgs/applications/science/logic/aiger/fix-missing-header.patch @@ -0,0 +1,11 @@ +diff -ur a/aigunconstraint.c b/aigunconstraint.c +--- a/aigunconstraint.c 2013-10-06 09:08:03.000000000 -0400 ++++ b/aigunconstraint.c 2023-10-27 08:55:01.678566389 -0400 +@@ -26,6 +26,7 @@ + #include <stdarg.h> + #include <stdlib.h> + #include <string.h> ++#include <unistd.h> + + static const char * USAGE = + "usage: aigunconstraint [-h][-v] [<input> [<output>]]\n" diff --git a/pkgs/applications/science/logic/alt-ergo/default.nix b/pkgs/applications/science/logic/alt-ergo/default.nix index ce084c1f4a7..bc8c6ae4858 100644 --- a/pkgs/applications/science/logic/alt-ergo/default.nix +++ b/pkgs/applications/science/logic/alt-ergo/default.nix @@ -1,47 +1,35 @@ -{ fetchFromGitHub, fetchpatch, lib, which, ocamlPackages }: +{ fetchurl, fetchpatch, lib, ocamlPackages }: let pname = "alt-ergo"; - version = "2.4.3"; + version = "2.5.2"; - configureScript = "ocaml unix.cma configure.ml"; - - src = fetchFromGitHub { - owner = "OCamlPro"; - repo = pname; - rev = "refs/tags/${version}"; - hash = "sha256-2XARGr8rLiPMOM0rBBoRv5tZvKYtkLkJctGqLYkMe7Q="; + src = fetchurl { + url = "https://github.com/OCamlPro/alt-ergo/releases/download/v${version}/alt-ergo-${version}.tbz"; + hash = "sha256-9GDBcBH49sheO5AjmDsznMEbw0JSrnSOcIIRN40/aJU="; }; in let alt-ergo-lib = ocamlPackages.buildDunePackage rec { pname = "alt-ergo-lib"; - inherit version src configureScript; - configureFlags = [ pname ]; - nativeBuildInputs = [ which ]; - buildInputs = with ocamlPackages; [ dune-configurator ]; - propagatedBuildInputs = with ocamlPackages; [ dune-build-info num ocplib-simplex seq stdlib-shims zarith ]; - preBuild = '' - substituteInPlace src/lib/util/version.ml --replace 'version="dev"' 'version="${version}"' - ''; + inherit version src; + buildInputs = with ocamlPackages; [ ppx_blob ]; + propagatedBuildInputs = with ocamlPackages; [ camlzip dolmen_loop dune-build-info fmt ocplib-simplex seq stdlib-shims zarith ]; }; in let alt-ergo-parsers = ocamlPackages.buildDunePackage rec { pname = "alt-ergo-parsers"; - inherit version src configureScript; - configureFlags = [ pname ]; - nativeBuildInputs = [ which ocamlPackages.menhir ]; - propagatedBuildInputs = [ alt-ergo-lib ] ++ (with ocamlPackages; [ camlzip psmt2-frontend ]); + inherit version src; + nativeBuildInputs = [ ocamlPackages.menhir ]; + propagatedBuildInputs = [ alt-ergo-lib ] ++ (with ocamlPackages; [ psmt2-frontend ]); }; in ocamlPackages.buildDunePackage { - inherit pname version src configureScript; - - configureFlags = [ pname ]; + inherit pname version src; - nativeBuildInputs = [ which ocamlPackages.menhir ]; - buildInputs = [ alt-ergo-parsers ocamlPackages.cmdliner ]; + nativeBuildInputs = [ ocamlPackages.menhir ]; + buildInputs = [ alt-ergo-parsers ] ++ (with ocamlPackages; [ cmdliner dune-site ]); meta = { description = "High-performance theorem prover and SMT solver"; diff --git a/pkgs/applications/science/logic/beluga/default.nix b/pkgs/applications/science/logic/beluga/default.nix index 3cb06c4e7b1..693be7f3388 100644 --- a/pkgs/applications/science/logic/beluga/default.nix +++ b/pkgs/applications/science/logic/beluga/default.nix @@ -2,13 +2,13 @@ ocamlPackages.buildDunePackage rec { pname = "beluga"; - version = "1.1"; + version = "1.1.1"; src = fetchFromGitHub { owner = "Beluga-lang"; repo = "Beluga"; rev = "refs/tags/v${version}"; - hash = "sha256-0E7rmiLmQPfOAQ1qKiqxeLdqviVl+Thkl6KfOWkGZRc="; + hash = "sha256-l/C77czLtlLnpadVx4d9ve9jv/e11jsOgzrbXt+Zo5s="; }; duneVersion = "3"; diff --git a/pkgs/applications/science/logic/cadical/default.nix b/pkgs/applications/science/logic/cadical/default.nix index a49aea8d40c..a9b27877ab1 100644 --- a/pkgs/applications/science/logic/cadical/default.nix +++ b/pkgs/applications/science/logic/cadical/default.nix @@ -2,13 +2,13 @@ stdenv.mkDerivation rec { pname = "cadical"; - version = "1.5.3"; + version = "1.8.0"; src = fetchFromGitHub { owner = "arminbiere"; repo = "cadical"; rev = "rel-${version}"; - sha256 = "sha256-3H/vowWfE1jfomYg2hOi3B3zjWa4CaLHAJXnoKWzskU="; + sha256 = "sha256-hY7+gTwBqQegbm5RjLKhM2vfBOjIRz797Z6wd6usj9s="; }; outputs = [ "out" "dev" "lib" ]; @@ -43,6 +43,6 @@ stdenv.mkDerivation rec { maintainers = with maintainers; [ shnarazk ]; platforms = platforms.unix; license = licenses.mit; - homepage = "http://fmv.jku.at/cadical"; + homepage = "https://fmv.jku.at/cadical/"; }; } diff --git a/pkgs/applications/science/logic/coq/default.nix b/pkgs/applications/science/logic/coq/default.nix index fe8180899c0..9717e69e9c2 100644 --- a/pkgs/applications/science/logic/coq/default.nix +++ b/pkgs/applications/science/logic/coq/default.nix @@ -217,7 +217,7 @@ self = stdenv.mkDerivation { together with an environment for semi-interactive development of machine-checked proofs. ''; - homepage = "http://coq.inria.fr"; + homepage = "https://coq.inria.fr"; license = licenses.lgpl21; branch = coq-version; maintainers = with maintainers; [ roconnor thoughtpolice vbgl Zimmi48 ]; diff --git a/pkgs/applications/science/logic/cryptominisat/default.nix b/pkgs/applications/science/logic/cryptominisat/default.nix index c5e263c319e..0645fd29522 100644 --- a/pkgs/applications/science/logic/cryptominisat/default.nix +++ b/pkgs/applications/science/logic/cryptominisat/default.nix @@ -8,13 +8,13 @@ stdenv.mkDerivation rec { pname = "cryptominisat"; - version = "5.11.12"; + version = "5.11.14"; src = fetchFromGitHub { owner = "msoos"; repo = "cryptominisat"; rev = version; - hash = "sha256-1AJx8gPf+qDpAp0p4cfCObKZDWKDAKdGopllr2ajpHw="; + hash = "sha256-p/sVinjEh078PGtJ6JBRA8EmrJVcchBs9L3bRZvCHuo="; }; buildInputs = [ python3 boost ]; diff --git a/pkgs/applications/science/logic/cryptoverif/default.nix b/pkgs/applications/science/logic/cryptoverif/default.nix index f056b3e433f..66ba807c8dd 100644 --- a/pkgs/applications/science/logic/cryptoverif/default.nix +++ b/pkgs/applications/science/logic/cryptoverif/default.nix @@ -2,31 +2,42 @@ stdenv.mkDerivation rec { pname = "cryptoverif"; - version = "2.05"; + version = "2.07"; src = fetchurl { url = "http://prosecco.gforge.inria.fr/personal/bblanche/cryptoverif/cryptoverif${version}.tar.gz"; - sha256 = "sha256-F5eVN5ATYo9Ivpi2eYh96ktuTWUeoqgWMR4BqHu8EFs="; + hash = "sha256-GXXql4+JZ396BM6W2I3kN0u59xos7UCAtzR0IjMIETY="; }; - strictDeps = true; - - nativeBuildInputs = [ ocaml ]; - /* Fix up the frontend to load the 'default' cryptoverif library ** from under $out/libexec. By default, it expects to find the files ** in $CWD which doesn't work. */ - patchPhase = '' + postPatch = '' substituteInPlace ./src/syntax.ml \ --replace \"default\" \"$out/libexec/default\" ''; - buildPhase = "./build"; + strictDeps = true; + + nativeBuildInputs = [ ocaml ]; + + buildPhase = '' + runHook preBuild + + ./build + + runHook postBuild + ''; + installPhase = '' + runHook preInstall + mkdir -p $out/bin $out/libexec cp ./cryptoverif $out/bin cp ./default.cvl $out/libexec cp ./default.ocvl $out/libexec + + runHook postInstall ''; meta = { diff --git a/pkgs/applications/science/logic/cvc3/default.nix b/pkgs/applications/science/logic/cvc3/default.nix index cfa8f62990c..0385909610e 100644 --- a/pkgs/applications/science/logic/cvc3/default.nix +++ b/pkgs/applications/science/logic/cvc3/default.nix @@ -5,7 +5,7 @@ stdenv.mkDerivation rec { version = "2.4.1"; src = fetchurl { - url = "http://www.cs.nyu.edu/acsys/cvc3/releases/${version}/${pname}-${version}.tar.gz"; + url = "https://cs.nyu.edu/acsys/cvc3/releases/${version}/${pname}-${version}.tar.gz"; sha256 = "1xxcwhz3y6djrycw8sm6xz83wb4hb12rd1n0skvc7fng0rh1snym"; }; @@ -32,11 +32,11 @@ stdenv.mkDerivation rec { [ raskin ]; platforms = platforms.unix; license = licenses.free; - homepage = "http://www.cs.nyu.edu/acsys/cvc3/index.html"; + homepage = "https://cs.nyu.edu/acsys/cvc3/index.html"; }; passthru = { updateInfo = { - downloadPage = "http://www.cs.nyu.edu/acsys/cvc3/download.html"; + downloadPage = "https://cs.nyu.edu/acsys/cvc3/download.html"; }; }; } diff --git a/pkgs/applications/science/logic/cvc4/default.nix b/pkgs/applications/science/logic/cvc4/default.nix index e9f04d2044d..1513c747798 100644 --- a/pkgs/applications/science/logic/cvc4/default.nix +++ b/pkgs/applications/science/logic/cvc4/default.nix @@ -35,9 +35,8 @@ stdenv.mkDerivation rec { preConfigure = '' patchShebangs ./src/ ''; - cmakeFlags = [ - "-DCMAKE_BUILD_TYPE=Production" - ]; + + cmakeBuildType = "Production"; meta = with lib; { description = "A high-performance theorem prover and SMT solver"; diff --git a/pkgs/applications/science/logic/cvc5/default.nix b/pkgs/applications/science/logic/cvc5/default.nix index b8a05074aaa..7c483ec185c 100644 --- a/pkgs/applications/science/logic/cvc5/default.nix +++ b/pkgs/applications/science/logic/cvc5/default.nix @@ -21,8 +21,9 @@ stdenv.mkDerivation rec { patchShebangs ./src/ ''; + cmakeBuildType = "Production"; + cmakeFlags = [ - "-DCMAKE_BUILD_TYPE=Production" "-DBUILD_SHARED_LIBS=1" "-DANTLR3_JAR=${antlr3_4}/lib/antlr/antlr-3.4-complete.jar" ]; diff --git a/pkgs/applications/science/logic/dafny/default.nix b/pkgs/applications/science/logic/dafny/default.nix index 2b30d3aeeb4..7da1958af38 100644 --- a/pkgs/applications/science/logic/dafny/default.nix +++ b/pkgs/applications/science/logic/dafny/default.nix @@ -8,28 +8,36 @@ buildDotnetModule rec { pname = "Dafny"; - version = "4.2.0"; + version = "4.3.0"; src = fetchFromGitHub { owner = "dafny-lang"; repo = "dafny"; rev = "v${version}"; - sha256 = "sha256-RSGaOgGf3m94t3SKnvSPqz0VHhWr6NmIMtGsmOynMaM="; + hash = "sha256-bnKaaqh1/921SRwnwqgYb31SJ8vguEBtzywPTz79S6I="; }; - postPatch = '' - cp ${writeScript "fake-gradlew-for-dafny" '' - mkdir -p build/libs/ - javac $(find -name "*.java" | grep "^./src/main") -d classes - jar cf build/libs/DafnyRuntime-${version}.jar -C classes dafny - ''} Source/DafnyRuntime/DafnyRuntimeJava/gradlew - - # Needed to fix - # "error NETSDK1129: The 'Publish' target is not supported without specifying a target framework. The current project targets multiple frameworks, you must specify the framework for the published application." - substituteInPlace Source/DafnyRuntime/DafnyRuntime.csproj \ - --replace TargetFrameworks TargetFramework \ - --replace "netstandard2.0;net452" net6.0 - ''; + postPatch = + # This version number seems to be hardcoded and didn't get updated with the + # version bump from 4.2.0 to 4.3.0. + let dafnyRuntimeJarVersion = "4.2.0"; + in '' + cp ${ + writeScript "fake-gradlew-for-dafny" '' + mkdir -p build/libs/ + javac $(find -name "*.java" | grep "^./src/main") -d classes + jar cf build/libs/DafnyRuntime-${dafnyRuntimeJarVersion}.jar -C classes dafny + ''} Source/DafnyRuntime/DafnyRuntimeJava/gradlew + + # Needed to fix + # "error NETSDK1129: The 'Publish' target is not supported without + # specifying a target framework. The current project targets multiple + # frameworks, you must specify the framework for the published + # application." + substituteInPlace Source/DafnyRuntime/DafnyRuntime.csproj \ + --replace TargetFrameworks TargetFramework \ + --replace "netstandard2.0;net452" net6.0 + ''; buildInputs = [ jdk11 ]; nugetDeps = ./deps.nix; diff --git a/pkgs/applications/science/logic/easycrypt/default.nix b/pkgs/applications/science/logic/easycrypt/default.nix index abd2b0cb275..32243455ae5 100644 --- a/pkgs/applications/science/logic/easycrypt/default.nix +++ b/pkgs/applications/science/logic/easycrypt/default.nix @@ -1,25 +1,16 @@ -{ lib, stdenv, fetchFromGitHub, fetchpatch, ocamlPackages, why3 }: +{ lib, stdenv, fetchFromGitHub, ocamlPackages, why3 }: stdenv.mkDerivation rec { pname = "easycrypt"; - version = "2022.04"; + version = "2023.09"; src = fetchFromGitHub { owner = pname; repo = pname; rev = "r${version}"; - sha256 = "sha256:09rdwcj70lkamkhd895p284rfpz4bcnsf55mcimhiqncd2a21ml7"; + hash = "sha256-9xavU9jRisZekPqC87EyiLXtZCGu/9QeGzq6BJGt1+Y="; }; - patches = lib.lists.map fetchpatch [ - # Fix build with Why3 1.5 - { url = "https://github.com/EasyCrypt/easycrypt/commit/d226387432deb7f22738e1d5579346a2cbc9be7a.patch"; - hash = "sha256:1zvxij35fnr3h9b5wdl8ml17aqfx3a39rd4mgwmdvkapbg3pa4lm"; } - # Fix build with Why3 1.6 - { url = "https://github.com/EasyCrypt/easycrypt/commit/876f2ed50a0434afdf2fb20e7c50b8a3e26bb06e.patch"; - hash = "sha256-UycfLZWYHNsppb7qHSRaAF4Y0UnwoFueEG0wUcBUPYE="; } - ]; - nativeBuildInputs = with ocamlPackages; [ dune_3 findlib diff --git a/pkgs/applications/science/logic/eprover/default.nix b/pkgs/applications/science/logic/eprover/default.nix index 400d636346c..ec1fc6b11d2 100644 --- a/pkgs/applications/science/logic/eprover/default.nix +++ b/pkgs/applications/science/logic/eprover/default.nix @@ -2,11 +2,11 @@ stdenv.mkDerivation rec { pname = "eprover"; - version = "2.6"; + version = "3.0"; src = fetchurl { url = "https://wwwlehre.dhbw-stuttgart.de/~sschulz/WORK/E_DOWNLOAD/V_${version}/E.tgz"; - sha256 = "sha256-qh896qIpFR5g1gdWAwGkbNJLBqUQCeCpuoYHHkDXPt0="; + hash = "sha256-gBgDC+GH948JMsjzo/SOpWDzJXu0g58YX1VW28PeorI="; }; buildInputs = [ which ]; diff --git a/pkgs/applications/science/logic/kissat/default.nix b/pkgs/applications/science/logic/kissat/default.nix index 5f982508c8c..d1703340527 100644 --- a/pkgs/applications/science/logic/kissat/default.nix +++ b/pkgs/applications/science/logic/kissat/default.nix @@ -4,13 +4,13 @@ stdenv.mkDerivation rec { pname = "kissat"; - version = "3.1.0"; + version = "3.1.1"; src = fetchFromGitHub { owner = "arminbiere"; repo = "kissat"; rev = "rel-${version}"; - sha256 = "sha256-AFUVkkD+toOfVEvIKfz3ncEdABLRxs9yQ8aJx6Q0ETM="; + sha256 = "sha256-zK20/vhbVihrxmd52DjByDUO99pBAr8SlJtQpX5fmwY="; }; outputs = [ "out" "dev" "lib" ]; @@ -48,6 +48,6 @@ stdenv.mkDerivation rec { maintainers = with maintainers; [ shnarazk ]; platforms = platforms.unix; license = licenses.mit; - homepage = "http://fmv.jku.at/kissat"; + homepage = "https://fmv.jku.at/kissat"; }; } diff --git a/pkgs/applications/science/logic/klee/default.nix b/pkgs/applications/science/logic/klee/default.nix index 401b2f48a6e..68f68355f81 100644 --- a/pkgs/applications/science/logic/klee/default.nix +++ b/pkgs/applications/science/logic/klee/default.nix @@ -72,10 +72,11 @@ in stdenv.mkDerivation rec { (lit.override { python = kleePython; }) ]; + cmakeBuildType = if debug then "Debug" else if !debug && includeDebugInfo then "RelWithDebInfo" else "MinSizeRel"; + cmakeFlags = let onOff = val: if val then "ON" else "OFF"; in [ - "-DCMAKE_BUILD_TYPE=${if debug then "Debug" else if !debug && includeDebugInfo then "RelWithDebInfo" else "MinSizeRel"}" "-DKLEE_RUNTIME_BUILD_TYPE=${if debugRuntime then "Debug" else "Release"}" "-DLLVMCC=${clang}/bin/clang" "-DLLVMCXX=${clang}/bin/clang++" diff --git a/pkgs/applications/science/logic/lean4/default.nix b/pkgs/applications/science/logic/lean4/default.nix index 7509ca63c80..ecc929cb5f0 100644 --- a/pkgs/applications/science/logic/lean4/default.nix +++ b/pkgs/applications/science/logic/lean4/default.nix @@ -9,13 +9,13 @@ stdenv.mkDerivation rec { pname = "lean4"; - version = "4.0.0"; + version = "4.2.0"; src = fetchFromGitHub { owner = "leanprover"; repo = "lean4"; rev = "v${version}"; - hash = "sha256-3Ni+NiD0iSsOruUyRpBd+aC0TZNYfOLhwqCpPHPruPg="; + hash = "sha256-56YtHCiNMP5fJoddSokEl0ws06IwetYLer4aLCnujZA="; }; postPatch = '' diff --git a/pkgs/applications/science/logic/picosat/default.nix b/pkgs/applications/science/logic/picosat/default.nix index 48def5fc2e4..1fef05069a6 100644 --- a/pkgs/applications/science/logic/picosat/default.nix +++ b/pkgs/applications/science/logic/picosat/default.nix @@ -5,7 +5,7 @@ stdenv.mkDerivation rec { version = "965"; src = fetchurl { - url = "http://fmv.jku.at/picosat/${pname}-${version}.tar.gz"; + url = "https://fmv.jku.at/picosat/${pname}-${version}.tar.gz"; sha256 = "0m578rpa5rdn08d10kr4lbsdwp4402hpavrz6n7n53xs517rn5hm"; }; @@ -36,7 +36,7 @@ stdenv.mkDerivation rec { meta = { description = "SAT solver with proof and core support"; - homepage = "http://fmv.jku.at/picosat/"; + homepage = "https://fmv.jku.at/picosat/"; license = lib.licenses.mit; platforms = lib.platforms.unix; maintainers = with lib.maintainers; [ roconnor thoughtpolice ]; diff --git a/pkgs/applications/science/logic/proverif/default.nix b/pkgs/applications/science/logic/proverif/default.nix index 57220aa523c..5cd0e5ff9e3 100644 --- a/pkgs/applications/science/logic/proverif/default.nix +++ b/pkgs/applications/science/logic/proverif/default.nix @@ -2,11 +2,11 @@ stdenv.mkDerivation rec { pname = "proverif"; - version = "2.04"; + version = "2.05"; src = fetchurl { url = "https://bblanche.gitlabpages.inria.fr/proverif/proverif${version}.tar.gz"; - sha256 = "sha256:0xgwnp59779xc40sb7ck8rmfn620pilxyq79l3bymj9m7z0mwvm9"; + hash = "sha256-SHH1PDKrSgRmmgYMSIa6XZCASWlj+5gKmmLSxCnOq8Q="; }; strictDeps = true; diff --git a/pkgs/applications/science/logic/surelog/default.nix b/pkgs/applications/science/logic/surelog/default.nix index d8c762de60c..5c7be408bf4 100644 --- a/pkgs/applications/science/logic/surelog/default.nix +++ b/pkgs/applications/science/logic/surelog/default.nix @@ -11,17 +11,18 @@ , uhdm , antlr4 , capnproto +, nlohmann_json }: stdenv.mkDerivation (finalAttrs: { pname = "surelog"; - version = "1.73"; + version = "1.76"; src = fetchFromGitHub { owner = "chipsalliance"; repo = finalAttrs.pname; rev = "v${finalAttrs.version}"; - hash = "sha256-z47Eqs3fP53pbEb3s66CqMiO4UpEwox+fKakxtRBakQ="; + hash = "sha256-Vg9NZrgzFRVIsEbZQe8DItDhFOVG1XZoQWBrLzVNwLU="; fetchSubmodules = false; # we use all dependencies from nix }; @@ -43,6 +44,7 @@ stdenv.mkDerivation (finalAttrs: { uhdm capnproto antlr4.runtime.cpp + nlohmann_json ]; cmakeFlags = [ @@ -50,6 +52,7 @@ stdenv.mkDerivation (finalAttrs: { "-DSURELOG_USE_HOST_UHDM=On" "-DSURELOG_USE_HOST_GTEST=On" "-DSURELOG_USE_HOST_ANTLR=On" + "-DSURELOG_USE_HOST_JSON=On" "-DANTLR_JAR_LOCATION=${antlr4.jarLocation}" ]; diff --git a/pkgs/applications/science/logic/uhdm/default.nix b/pkgs/applications/science/logic/uhdm/default.nix index c1acd79dcab..ec25d58efcb 100644 --- a/pkgs/applications/science/logic/uhdm/default.nix +++ b/pkgs/applications/science/logic/uhdm/default.nix @@ -9,13 +9,14 @@ stdenv.mkDerivation (finalAttrs: { pname = "UHDM"; - version = "1.73"; + # When updating this package, also consider updating science/logic/surelog + version = "1.77"; src = fetchFromGitHub { owner = "chipsalliance"; repo = finalAttrs.pname; rev = "v${finalAttrs.version}"; - hash = "sha256-VmRn51UrJTGEG4n2fi5kRv8khXakfGbqMtYPejsZCBI="; + hash = "sha256-JKhpcPG4hWlcn2C+Wlx7yNIMXXurAMxLSK4xWN2akMQ="; fetchSubmodules = false; # we use all dependencies from nix }; diff --git a/pkgs/applications/science/logic/vampire/default.nix b/pkgs/applications/science/logic/vampire/default.nix index 253c88705ae..a3c1aa3f131 100644 --- a/pkgs/applications/science/logic/vampire/default.nix +++ b/pkgs/applications/science/logic/vampire/default.nix @@ -19,13 +19,13 @@ stdenv.mkDerivation rec { # https://github.com/vprover/vampire/pull/54 (fetchpatch { name = "fix-apple-cygwin-defines.patch"; - url = "https://github.com/vprover/vampire/pull/54.patch"; + url = "https://github.com/vprover/vampire/commit/b4bddd3bcac6a7688742da75c369b7b3213f6d1c.patch"; sha256 = "0i6nrc50wlg1dqxq38lkpx4rmfb3lf7s8f95l4jkvqp0nxa20cza"; }) # https://github.com/vprover/vampire/pull/55 (fetchpatch { name = "fix-wait-any.patch"; - url = "https://github.com/vprover/vampire/pull/55.patch"; + url = "https://github.com/vprover/vampire/commit/6da10eabb333aec54cdf13833ea33cb851159543.patch"; sha256 = "1pwfpwpl23bqsgkmmvw6bnniyvp5j9v8l3z9s9pllfabnfcrcz9l"; }) ]; diff --git a/pkgs/applications/science/logic/z3/default.nix b/pkgs/applications/science/logic/z3/default.nix index 9fe39c8cef8..6165cfe8bd2 100644 --- a/pkgs/applications/science/logic/z3/default.nix +++ b/pkgs/applications/science/logic/z3/default.nix @@ -47,7 +47,7 @@ let common = { version, sha256, patches ? [ ], tag ? "z3" }: configurePhase = concatStringsSep " " ( - [ "${python.pythonForBuild.interpreter} scripts/mk_make.py --prefix=$out" ] + [ "${python.pythonOnBuildForHost.interpreter} scripts/mk_make.py --prefix=$out" ] ++ optional javaBindings "--java" ++ optional ocamlBindings "--ml" ++ optional pythonBindings "--python --pypkgdir=$out/${python.sitePackages}" diff --git a/pkgs/applications/science/math/R/default.nix b/pkgs/applications/science/math/R/default.nix index d3ca419c48d..f4cc1f1fbfe 100644 --- a/pkgs/applications/science/math/R/default.nix +++ b/pkgs/applications/science/math/R/default.nix @@ -1,5 +1,5 @@ { lib, stdenv, fetchurl, bzip2, gfortran, libX11, libXmu, libXt, libjpeg, libpng -, libtiff, ncurses, pango, pcre2, perl, readline, tcl, texlive, texLive, tk, xz, zlib +, libtiff, ncurses, pango, pcre2, perl, readline, tcl, texlive, texliveSmall, tk, xz, zlib , less, texinfo, graphviz, icu, pkg-config, bison, imake, which, jdk, blas, lapack , curl, Cocoa, Foundation, libobjc, libcxx, tzdata , withRecommendedPackages ? true @@ -15,13 +15,13 @@ assert (!blas.isILP64) && (!lapack.isILP64); stdenv.mkDerivation (finalAttrs: { pname = "R"; - version = "4.3.1"; + version = "4.3.2"; src = let inherit (finalAttrs) pname version; in fetchurl { url = "https://cran.r-project.org/src/base/R-${lib.versions.major version}/${pname}-${version}.tar.gz"; - sha256 = "sha256-jdC/JPECPG9hjDsxc4PSkbSklPQNc7mDrCL/6pnkupk="; + sha256 = "sha256-s/V2CsLu6AJqPw7vyyW0dyPZeAOO7o6ER2IJTIYMRSo="; }; outputs = [ "out" "tex" ]; @@ -31,7 +31,7 @@ stdenv.mkDerivation (finalAttrs: { nativeBuildInputs = [ pkg-config ]; buildInputs = [ bzip2 gfortran libX11 libXmu libXt libXt libjpeg libpng libtiff ncurses - pango pcre2 perl readline texLive xz zlib less texinfo graphviz icu + pango pcre2 perl readline (texliveSmall.withPackages (ps: with ps; [ inconsolata helvetic ps.texinfo fancyvrb cm-super rsfs ])) xz zlib less texinfo graphviz icu bison imake which blas lapack curl tcl tk jdk tzdata ] ++ lib.optionals stdenv.isDarwin [ Cocoa Foundation libobjc libcxx ]; diff --git a/pkgs/applications/science/math/caffe/default.nix b/pkgs/applications/science/math/caffe/default.nix index 5af927294d6..42c16039359 100644 --- a/pkgs/applications/science/math/caffe/default.nix +++ b/pkgs/applications/science/math/caffe/default.nix @@ -1,12 +1,13 @@ { config, stdenv, lib , fetchFromGitHub , fetchurl +, fetchpatch , cmake , boost , gflags , glog , hdf5-cpp -, opencv3 +, opencv4 , protobuf , doxygen , blas @@ -71,7 +72,7 @@ stdenv.mkDerivation rec { ++ ["-DUSE_LEVELDB=${toggle leveldbSupport}"] ++ ["-DUSE_LMDB=${toggle lmdbSupport}"]; - buildInputs = [ boost gflags glog protobuf hdf5-cpp opencv3 blas ] + buildInputs = [ boost gflags glog protobuf hdf5-cpp opencv4 blas ] ++ lib.optional cudaSupport cudatoolkit ++ lib.optional cudnnSupport cudnn ++ lib.optional lmdbSupport lmdb @@ -96,6 +97,11 @@ stdenv.mkDerivation rec { patches = [ ./darwin.patch + (fetchpatch { + name = "support-opencv4"; + url = "https://github.com/BVLC/caffe/pull/6638/commits/0a04cc2ccd37ba36843c18fea2d5cbae6e7dd2b5.patch"; + hash = "sha256-ZegTvp0tTHlopQv+UzHDigs6XLkP2VfqLCWXl6aKJSI="; + }) ] ++ lib.optional pythonSupport (substituteAll { src = ./python.patch; inherit (python.sourceVersion) major minor; # Should be changed in case of PyPy @@ -148,7 +154,7 @@ stdenv.mkDerivation rec { ''; homepage = "http://caffe.berkeleyvision.org/"; maintainers = with maintainers; [ ]; - broken = pythonSupport && (python.isPy310); + broken = (pythonSupport && (python.isPy310)) || cudaSupport; license = licenses.bsd2; platforms = platforms.linux ++ platforms.darwin; }; diff --git a/pkgs/applications/science/math/calc/default.nix b/pkgs/applications/science/math/calc/default.nix index 0c70a6e03b2..86ec445d9b3 100644 --- a/pkgs/applications/science/math/calc/default.nix +++ b/pkgs/applications/science/math/calc/default.nix @@ -10,18 +10,18 @@ stdenv.mkDerivation (finalAttrs: { pname = "calc"; - version = "2.14.3.5"; + version = "2.15.0.1"; src = fetchurl { urls = [ "https://github.com/lcn2/calc/releases/download/v${finalAttrs.version}/calc-${finalAttrs.version}.tar.bz2" "http://www.isthe.com/chongo/src/calc/calc-${finalAttrs.version}.tar.bz2" ]; - hash = "sha256-4eXs6NDfsJO5Vr9Mo2jC16hTRAyt++1s+Z/JrWDKwUk="; + hash = "sha256-u/mt9y4805IWYDdEHz94dPb4V+d4YVrrhzz8v3B+q24="; }; postPatch = '' - substituteInPlace Makefile \ + substituteInPlace Makefile.target \ --replace '-install_name ''${LIBDIR}/libcalc''${LIB_EXT_VERSION}' '-install_name ''${T}''${LIBDIR}/libcalc''${LIB_EXT_VERSION}' \ --replace '-install_name ''${LIBDIR}/libcustcalc''${LIB_EXT_VERSION}' '-install_name ''${T}''${LIBDIR}/libcustcalc''${LIB_EXT_VERSION}' ''; diff --git a/pkgs/applications/science/math/clp/default.nix b/pkgs/applications/science/math/clp/default.nix index c7d19f044d6..52a74ff3979 100644 --- a/pkgs/applications/science/math/clp/default.nix +++ b/pkgs/applications/science/math/clp/default.nix @@ -1,13 +1,13 @@ { lib, stdenv, fetchFromGitHub, pkg-config, coin-utils, zlib, osi }: stdenv.mkDerivation rec { - version = "1.17.8"; + version = "1.17.9"; pname = "clp"; src = fetchFromGitHub { owner = "coin-or"; repo = "Clp"; rev = "releases/${version}"; - hash = "sha256-3Z6ysoCcDVB8UePiwbZNqvO/o/jgPcv6XFkpJZBK+Os="; + hash = "sha256-kHCDji+yIf5mCoxKB2b/HaATGmwwIAPEV74tthIMeMY="; }; nativeBuildInputs = [ pkg-config ]; diff --git a/pkgs/applications/science/math/cntk/default.nix b/pkgs/applications/science/math/cntk/default.nix deleted file mode 100644 index 91d208a56ed..00000000000 --- a/pkgs/applications/science/math/cntk/default.nix +++ /dev/null @@ -1,134 +0,0 @@ -{ lib, stdenv, fetchFromGitHub, cmake -, fetchpatch -, openblas, blas, lapack, opencv3, libzip, boost, protobuf, mpi -, onebitSGDSupport ? false -, config -, cudaSupport ? config.cudaSupport, cudaPackages ? { }, addOpenGLRunpath, cudatoolkit, nvidia_x11 -, cudnnSupport ? cudaSupport -}: - -let - inherit (cudaPackages) cudatoolkit cudnn; -in - -assert cudnnSupport -> cudaSupport; -assert blas.implementation == "openblas" && lapack.implementation == "openblas"; - -let - # Old specific version required for CNTK. - cub = fetchFromGitHub { - owner = "NVlabs"; - repo = "cub"; - rev = "1.7.4"; - sha256 = "0ksd5n1lxqhm5l5cd2lps4cszhjkf6gmzahaycs7nxb06qci8c66"; - }; - -in stdenv.mkDerivation rec { - pname = "CNTK"; - version = "2.7"; - - src = fetchFromGitHub { - owner = "Microsoft"; - repo = "CNTK"; - rev = "v${version}"; - sha256 = "sha256-2rIrPJyvZhnM5EO6tNhF6ARTocfUHce4N0IZk/SZiaI="; - fetchSubmodules = true; - }; - - patches = [ - # Fix build with protobuf 3.18+ - # Remove with onnx submodule bump to 1.9+ - (fetchpatch { - url = "https://github.com/onnx/onnx/commit/d3bc82770474761571f950347560d62a35d519d7.patch"; - extraPrefix = "Source/CNTKv2LibraryDll/proto/onnx/onnx_repo/"; - stripLen = 1; - sha256 = "00raqj8wx30b06ky6cdp5vvc1mrzs7hglyi6h58hchw5lhrwkzxp"; - }) - ]; - - postPatch = '' - # Fix build with protobuf 3.18+ - substituteInPlace Source/CNTKv2LibraryDll/Serialization.cpp \ - --replace 'SetTotalBytesLimit(INT_MAX, INT_MAX)' \ - 'SetTotalBytesLimit(INT_MAX)' \ - --replace 'SetTotalBytesLimit(limit, limit)' \ - 'SetTotalBytesLimit(limit)' - ''; - - nativeBuildInputs = [ cmake ] ++ lib.optional cudaSupport addOpenGLRunpath; - - # Force OpenMPI to use g++ in PATH. - OMPI_CXX = "g++"; - - # Uses some deprecated tensorflow functions - env.NIX_CFLAGS_COMPILE = "-Wno-error=deprecated-declarations"; - - buildInputs = [ openblas opencv3 libzip boost protobuf mpi ] - ++ lib.optional cudaSupport cudatoolkit - ++ lib.optional cudnnSupport cudnn; - - configureFlags = [ - "--with-opencv=${opencv3}" - "--with-libzip=${libzip.dev}" - "--with-openblas=${openblas.dev}" - "--with-boost=${boost.dev}" - "--with-protobuf=${protobuf}" - "--with-mpi=${mpi}" - "--cuda=${if cudaSupport then "yes" else "no"}" - # FIXME - "--asgd=no" - ] ++ lib.optionals cudaSupport [ - "--with-cuda=${cudatoolkit}" - "--with-gdk-include=${cudatoolkit}/include" - "--with-gdk-nvml-lib=${nvidia_x11}/lib" - "--with-cub=${cub}" - ] ++ lib.optional onebitSGDSupport "--1bitsgd=yes"; - - configurePhase = '' - sed -i \ - -e 's,^GIT_STATUS=.*,GIT_STATUS=,' \ - -e 's,^GIT_COMMIT=.*,GIT_COMMIT=v${version},' \ - -e 's,^GIT_BRANCH=.*,GIT_BRANCH=v${version},' \ - -e 's,^BUILDER=.*,BUILDER=nixbld,' \ - -e 's,^BUILDMACHINE=.*,BUILDMACHINE=machine,' \ - -e 's,^BUILDPATH=.*,BUILDPATH=/homeless-shelter,' \ - -e '/git does not exist/d' \ - Tools/generate_build_info - - patchShebangs . - mkdir build - cd build - ${lib.optionalString cudnnSupport '' - mkdir cuda - ln -s ${cudnn}/include cuda - export configureFlags="$configureFlags --with-cudnn=$PWD" - ''} - - ../configure $configureFlags - ''; - - installPhase = '' - mkdir -p $out/bin - # Moving to make patchelf remove references later. - mv lib $out - cp bin/cntk $out/bin - ''; - - postFixup = lib.optionalString cudaSupport '' - for lib in $out/lib/*; do - addOpenGLRunpath "$lib" - done - ''; - - meta = with lib; { - homepage = "https://github.com/Microsoft/CNTK"; - description = "An open source deep-learning toolkit"; - license = if onebitSGDSupport then licenses.unfreeRedistributable else licenses.mit; - platforms = [ "x86_64-linux" ]; - maintainers = with maintainers; [ abbradar ]; - # Newer cub is included with cudatoolkit now and it breaks the build. - # https://github.com/Microsoft/CNTK/issues/3191 - # broken = cudaSupport; - broken = true; # at 2022-11-23 - }; -} diff --git a/pkgs/applications/science/math/colpack/default.nix b/pkgs/applications/science/math/colpack/default.nix index 3cc9290a762..d5ab38ff751 100644 --- a/pkgs/applications/science/math/colpack/default.nix +++ b/pkgs/applications/science/math/colpack/default.nix @@ -35,7 +35,7 @@ stdenv.mkDerivation rec { meta = with lib; { description = "A package comprising of implementations of algorithms for vertex coloring and derivative computation"; - homepage = "http://cscapes.cs.purdue.edu/coloringpage/software.htm#functionalities"; + homepage = "https://cscapes.cs.purdue.edu/coloringpage/software.htm#functionalities"; license = licenses.lgpl3Plus; platforms = platforms.unix; maintainers = with maintainers; [ edwtjo ]; diff --git a/pkgs/applications/science/math/eigenmath/default.nix b/pkgs/applications/science/math/eigenmath/default.nix index 8abcd96f08d..1e80d9a06eb 100644 --- a/pkgs/applications/science/math/eigenmath/default.nix +++ b/pkgs/applications/science/math/eigenmath/default.nix @@ -7,13 +7,13 @@ stdenv.mkDerivation rec { pname = "eigenmath"; - version = "unstable-2023-08-03"; + version = "unstable-2023-11-17"; src = fetchFromGitHub { owner = "georgeweigt"; repo = pname; - rev = "f202cf0c342e54e994c4d416daecc1b1dc8b9c98"; - hash = "sha256-kp4zWTPYt2DiuPgTK+ib8NbKg2BJVxJDDCvIlWNuwgs="; + rev = "b0d822f10243ad5b1c88efb5a82b43a0bbf1bfbc"; + hash = "sha256-eJ/EmzV5UZGxwZNIna/XXkYY+vkLc610KcywBFPRfyM="; }; checkPhase = let emulator = stdenv.hostPlatform.emulator buildPackages; in '' diff --git a/pkgs/applications/science/math/giac/default.nix b/pkgs/applications/science/math/giac/default.nix index 752b05fe4fe..0dc12b6dcb0 100644 --- a/pkgs/applications/science/math/giac/default.nix +++ b/pkgs/applications/science/math/giac/default.nix @@ -1,4 +1,4 @@ -{ stdenv, lib, fetchurl, fetchpatch, texlive, bison, flex, lapack, blas +{ stdenv, lib, fetchurl, fetchpatch, texliveSmall, bison, flex, lapack, blas , autoreconfHook, gmp, mpfr, pari, ntl, gsl, mpfi, ecm, glpk, nauty , buildPackages, readline, gettext, libpng, libao, gfortran, perl , enableGUI ? false, libGL, libGLU, xorg, fltk @@ -60,7 +60,7 @@ stdenv.mkDerivation rec { ''; nativeBuildInputs = [ - autoreconfHook texlive.combined.scheme-small bison flex + autoreconfHook texliveSmall bison flex ]; # perl is only needed for patchShebangs fixup. diff --git a/pkgs/applications/science/math/ginac/default.nix b/pkgs/applications/science/math/ginac/default.nix index 057b242e609..d9d12cbf388 100644 --- a/pkgs/applications/science/math/ginac/default.nix +++ b/pkgs/applications/science/math/ginac/default.nix @@ -2,11 +2,11 @@ stdenv.mkDerivation rec { pname = "ginac"; - version = "1.8.6"; + version = "1.8.7"; src = fetchurl { url = "https://www.ginac.de/ginac-${version}.tar.bz2"; - sha256 = "sha256-ALMgsRFsrlt7QzZNv/t5EkcdFx9ITYJ2RgXXFYWNl1s="; + sha256 = "sha256-cf9PLYoA5vB86P7mm3bcweu7cnvmdgtYfB+7XM97Yeo="; }; propagatedBuildInputs = [ cln ]; diff --git a/pkgs/applications/science/math/mxnet/default.nix b/pkgs/applications/science/math/mxnet/default.nix index d65de87d8eb..993da2b8989 100644 --- a/pkgs/applications/science/math/mxnet/default.nix +++ b/pkgs/applications/science/math/mxnet/default.nix @@ -1,5 +1,5 @@ { config, stdenv, lib, fetchurl, fetchpatch, bash, cmake -, opencv3, gtest, blas, gomp, llvmPackages, perl +, opencv4, gtest, blas, gomp, llvmPackages, perl , cudaSupport ? config.cudaSupport, cudaPackages ? { }, nvidia_x11 , cudnnSupport ? cudaSupport }: @@ -37,7 +37,7 @@ stdenv.mkDerivation rec { nativeBuildInputs = [ cmake perl ]; - buildInputs = [ opencv3 gtest blas.provider ] + buildInputs = [ opencv4 gtest blas.provider ] ++ lib.optional stdenv.cc.isGNU gomp ++ lib.optional stdenv.cc.isClang llvmPackages.openmp # FIXME: when cuda build is fixed, remove nvidia_x11, and use /run/opengl-driver/lib diff --git a/pkgs/applications/science/math/pari/default.nix b/pkgs/applications/science/math/pari/default.nix index 44647ce8139..2480ff3eba8 100644 --- a/pkgs/applications/science/math/pari/default.nix +++ b/pkgs/applications/science/math/pari/default.nix @@ -7,7 +7,7 @@ , libpthreadstubs , perl , readline -, tex +, texliveBasic , withThread ? true }: @@ -31,7 +31,7 @@ stdenv.mkDerivation rec { libX11 perl readline - tex + texliveBasic ] ++ lib.optionals withThread [ libpthreadstubs ]; diff --git a/pkgs/applications/science/math/polymake/default.nix b/pkgs/applications/science/math/polymake/default.nix index 2e79ca03635..fe9210641d2 100644 --- a/pkgs/applications/science/math/polymake/default.nix +++ b/pkgs/applications/science/math/polymake/default.nix @@ -28,13 +28,13 @@ in stdenv.mkDerivation rec { pname = "polymake"; - version = "4.10"; + version = "4.11"; src = fetchurl { # "The minimal version is a packager friendly version which omits # the bundled sources of cdd, lrs, libnormaliz, nauty and jReality." url = "https://polymake.org/lib/exe/fetch.php/download/polymake-${version}-minimal.tar.bz2"; - sha256 = "sha256-YDiyZtbUC76ZVe3oRtzPRBfkEU+qh+d1ZWFhzUyi+Pg="; + sha256 = "sha256-XfbwrNcAEZvQxLV2Z2KFL/vYV3ZbXcyIgC/10hCK3SM="; }; nativeBuildInputs = [ diff --git a/pkgs/applications/science/math/qalculate-gtk/default.nix b/pkgs/applications/science/math/qalculate-gtk/default.nix index 191ee7a00fd..ade614c89b0 100644 --- a/pkgs/applications/science/math/qalculate-gtk/default.nix +++ b/pkgs/applications/science/math/qalculate-gtk/default.nix @@ -1,4 +1,4 @@ -{ lib, stdenv, fetchFromGitHub, intltool, autoreconfHook, pkg-config, libqalculate, gtk3, curl, wrapGAppsHook }: +{ lib, stdenv, fetchFromGitHub, intltool, autoreconfHook, pkg-config, libqalculate, gtk3, curl, wrapGAppsHook, desktopToDarwinBundle }: stdenv.mkDerivation (finalAttrs: { pname = "qalculate-gtk"; @@ -13,7 +13,8 @@ stdenv.mkDerivation (finalAttrs: { hardeningDisable = [ "format" ]; - nativeBuildInputs = [ intltool pkg-config autoreconfHook wrapGAppsHook ]; + nativeBuildInputs = [ intltool pkg-config autoreconfHook wrapGAppsHook ] + ++ lib.optionals stdenv.isDarwin [ desktopToDarwinBundle ]; buildInputs = [ libqalculate gtk3 curl ]; enableParallelBuilding = true; diff --git a/pkgs/applications/science/math/readstat/default.nix b/pkgs/applications/science/math/readstat/default.nix index efbf80ba16e..08555d12640 100644 --- a/pkgs/applications/science/math/readstat/default.nix +++ b/pkgs/applications/science/math/readstat/default.nix @@ -1,4 +1,4 @@ -{ lib, stdenv, fetchFromGitHub, autoreconfHook, pkg-config, libiconv }: +{ lib, stdenv, fetchFromGitHub, fetchpatch, autoreconfHook, pkg-config, libiconv }: stdenv.mkDerivation rec { pname = "readstat"; @@ -11,6 +11,13 @@ stdenv.mkDerivation rec { sha256 = "sha256-4lRJgZPB2gfaQ9fQKvDDpGhy1eDNT/nT1QmeZlCmCis="; }; + patches = [ + (fetchpatch { + url = "https://github.com/WizardMac/ReadStat/commit/211c342a1cfe46fb7fb984730dd7a29ff4752f35.patch"; + hash = "sha256-nkaEgusylVu7NtzSzBklBuOnqO9qJPovf0qn9tTE6ls="; + }) + ]; + nativeBuildInputs = [ pkg-config autoreconfHook ]; buildInputs = [ libiconv ]; @@ -22,5 +29,6 @@ stdenv.mkDerivation rec { description = "Command-line tool (+ C library) for converting SAS, Stata, and SPSS files"; license = lib.licenses.mit; maintainers = with lib.maintainers; [ swflint ]; + platforms = lib.platforms.all; }; } diff --git a/pkgs/applications/science/math/sage/README.md b/pkgs/applications/science/math/sage/README.md index c4de5da45db..35e8d0deeff 100644 --- a/pkgs/applications/science/math/sage/README.md +++ b/pkgs/applications/science/math/sage/README.md @@ -2,7 +2,7 @@ Sage is a pretty complex package that depends on many other complex packages and patches some of those. As a result, the sage nix package is also quite complex. -Don't feel discouraged to fix, simplify or improve things though. The individual files have comments explaining their purpose. The most importent ones are `default.nix` linking everything together, `sage-src.nix` adding patches and `sagelib.nix` building the actual sage package. +Don't feel discouraged to fix, simplify or improve things though. The individual files have comments explaining their purpose. The most important ones are `default.nix` linking everything together, `sage-src.nix` adding patches and `sagelib.nix` building the actual sage package. ## The sage build is broken diff --git a/pkgs/applications/science/math/sage/sage-src.nix b/pkgs/applications/science/math/sage/sage-src.nix index 9fe07603fe7..97754c04d95 100644 --- a/pkgs/applications/science/math/sage/sage-src.nix +++ b/pkgs/applications/science/math/sage/sage-src.nix @@ -104,11 +104,32 @@ stdenv.mkDerivation rec { sha256 = "sha256-GqMgoi0tsP7zcCcPumhdsbvhPB6fgw1ufx6gHlc6iSc="; }) - # https://github.com/sagemath/sage/pull/36006, positively reviewed + # https://github.com/sagemath/sage/pull/36006, landed in 10.2.beta2 (fetchpatch { name = "gmp-6.3-upgrade.patch"; - url = "https://github.com/sagemath/sage/commit/d88bc3815c0901bfdeaa3e4a31107c084199f614.diff"; - sha256 = "sha256-dXaEwk2wXxmx02sCw4Vu9mF0ZrydhFD4LRwNAiQsPgM="; + url = "https://github.com/sagemath/sage/commit/5e841de46c3baa99cd1145b36ff9163e9340a55c.diff"; + sha256 = "sha256-fJPDryLtGBQz9qHDiCkBwjiW2lN6v7HiHgxY7CTeHcs="; + }) + + # https://github.com/sagemath/sage/pull/36279, landed in 10.2.beta4 + (fetchpatch { + name = "matplotlib-3.8-upgrade.patch"; + url = "https://github.com/sagemath/sage/commit/0fcf88935908440930c5f79202155aca4ad57518.diff"; + sha256 = "sha256-mvqAHaTCXsxPv901L8HSTnrfghfXYdq0wfLoP/cYQZI="; + }) + + # https://github.com/sagemath/sage/pull/35658, landed in 10.1.beta2 + (fetchpatch { + name = "sphinx-7-upgrade.patch"; + url = "https://github.com/sagemath/sage/commit/cacd9a89b5c4fdcf84a8dd2b7d5bdc10cc78109a.diff"; + sha256 = "sha256-qJvliTJjR3XBc5pH6Q0jtm8c4bhtZcTcF3O04Ro1uaU="; + }) + + # https://github.com/sagemath/sage/pull/36296, landed in 10.2.beta4 + (fetchpatch { + name = "duplicate-args-region_plot.patch"; + url = "https://github.com/sagemath/sage/commit/461727b453712550a2c5dc0ae11933523255aaed.diff"; + sha256 = "sha256-mC8084VQoUBk4hocALF+Y9Cwb38Zt360eldi/SSjna8="; }) ]; diff --git a/pkgs/applications/science/math/sage/sagelib.nix b/pkgs/applications/science/math/sage/sagelib.nix index d8d5586e219..f8beabaac1f 100644 --- a/pkgs/applications/science/math/sage/sagelib.nix +++ b/pkgs/applications/science/math/sage/sagelib.nix @@ -78,6 +78,7 @@ , sphinx , sympy , typing-extensions +, nbclassic }: assert (!blas.isILP64) && (!lapack.isILP64); @@ -181,6 +182,8 @@ buildPythonPackage rec { sphinx sympy typing-extensions + + nbclassic ]; preBuild = '' diff --git a/pkgs/applications/science/math/singular/default.nix b/pkgs/applications/science/math/singular/default.nix index 1f06f0d1aef..f77bd5a9224 100644 --- a/pkgs/applications/science/math/singular/default.nix +++ b/pkgs/applications/science/math/singular/default.nix @@ -17,7 +17,7 @@ # use letters instead of numbers for post-appendix chapters, and we # want it to match the upstream format because sage depends on it. , texinfo4 -, texlive +, texliveSmall , enableDocs ? !stdenv.isDarwin , enableGfanlib ? true }: @@ -86,7 +86,7 @@ stdenv.mkDerivation rec { graphviz latex2html texinfo4 - texlive.combined.scheme-small + texliveSmall ] ++ lib.optionals stdenv.isDarwin [ getconf ]; depsBuildBuild = [ buildPackages.stdenv.cc ]; diff --git a/pkgs/applications/science/math/wxmaxima/default.nix b/pkgs/applications/science/math/wxmaxima/default.nix index c475dbd5ef2..d30d560f47f 100644 --- a/pkgs/applications/science/math/wxmaxima/default.nix +++ b/pkgs/applications/science/math/wxmaxima/default.nix @@ -12,13 +12,13 @@ stdenv.mkDerivation (finalAttrs:{ pname = "wxmaxima"; - version = "23.02.1"; + version = "23.10.0"; src = fetchFromGitHub { owner = "wxMaxima-developers"; repo = "wxmaxima"; rev = "Version-${finalAttrs.version}"; - sha256 = "sha256-Lrj/oJNmKlCkNbnCGY2TewCospwajKdWgmKkreHzEIU="; + sha256 = "sha256-3zQzpw0KWNAAvML55O2FMlid9j0GtP8OWy1eqifzVwI="; }; buildInputs = [ diff --git a/pkgs/applications/science/misc/boinc/default.nix b/pkgs/applications/science/misc/boinc/default.nix index 4721e946464..45209881f7a 100644 --- a/pkgs/applications/science/misc/boinc/default.nix +++ b/pkgs/applications/science/misc/boinc/default.nix @@ -27,14 +27,14 @@ stdenv.mkDerivation rec { pname = "boinc"; - version = "7.24.1"; + version = "7.24.2"; src = fetchFromGitHub { name = "${pname}-${version}-src"; owner = "BOINC"; repo = "boinc"; rev = "client_release/${lib.versions.majorMinor version}/${version}"; - hash = "sha256-CAzAKxNHG8ew9v2B1jK7MxfWGwTfdmDncDe7QT+twd8="; + hash = "sha256-Aaoqf53wagCkzkZUs7mVbE2Z2P6GvxiQYxPrL6ahGqA="; }; nativeBuildInputs = [ libtool automake autoconf m4 pkg-config ]; diff --git a/pkgs/applications/science/misc/root/5.nix b/pkgs/applications/science/misc/root/5.nix index 4a8411cd34f..2d830e3d101 100644 --- a/pkgs/applications/science/misc/root/5.nix +++ b/pkgs/applications/science/misc/root/5.nix @@ -64,6 +64,9 @@ stdenv.mkDerivation rec { url = "https://github.com/root-project/root/commit/c75458024082de0cc35b45505c652b8460a9e71b.patch"; sha256 = "sha256-A5zEjQE9OGPFp/L1HUs4NIdxQMRiwbwCRNWOLN2ENrM="; }) + # Backport Python 3.11 fix to v5 from v6.26 + # https://github.com/root-project/root/commit/484deb056dacf768aba4954073b41105c431bffc + ./root5-python311-fix.patch ]; # https://github.com/root-project/root/issues/13216 diff --git a/pkgs/applications/science/misc/root/default.nix b/pkgs/applications/science/misc/root/default.nix index 6dc630181be..d2172f614f6 100644 --- a/pkgs/applications/science/misc/root/default.nix +++ b/pkgs/applications/science/misc/root/default.nix @@ -2,6 +2,7 @@ , lib , callPackage , fetchurl +, fetchpatch , makeWrapper , cmake , coreutils @@ -57,7 +58,7 @@ stdenv.mkDerivation rec { pname = "root"; - version = "6.28.06"; + version = "6.28.08"; passthru = { tests = import ./tests { inherit callPackage; }; @@ -65,7 +66,7 @@ stdenv.mkDerivation rec { src = fetchurl { url = "https://root.cern.ch/download/root_v${version}.source.tar.gz"; - hash = "sha256-rztnO5rKOTpcmuG/huqyZyqvGEG2WMXG56MKuTxYZTM="; + hash = "sha256-o+ZLTAH4fNm75X5h75a0FibkmwRGCVBw1B2b+6NSaGI="; }; nativeBuildInputs = [ makeWrapper cmake pkg-config git ]; diff --git a/pkgs/applications/science/misc/root/root5-python311-fix.patch b/pkgs/applications/science/misc/root/root5-python311-fix.patch new file mode 100644 index 00000000000..3005b3a73f9 --- /dev/null +++ b/pkgs/applications/science/misc/root/root5-python311-fix.patch @@ -0,0 +1,17 @@ +diff --git a/bindings/pyroot/src/MethodProxy.cxx b/bindings/pyroot/src/MethodProxy.cxx +--- a/bindings/pyroot/src/MethodProxy.cxx ++++ b/bindings/pyroot/src/MethodProxy.cxx +@@ -4,10 +4,10 @@ + // Bindings + #include "PyROOT.h" + #include "structmember.h" // from Python +-#if PY_VERSION_HEX >= 0x02050000 +-#include "code.h" // from Python +-#else ++#if PY_VERSION_HEX < 0x02050000 + #include "compile.h" // from Python ++#elif PY_VERSION_HEX < 0x030b0000 ++#include "code.h" // from Python + #endif + #ifndef CO_NOFREE + // python2.2 does not have CO_NOFREE defined diff --git a/pkgs/applications/science/misc/snakemake/default.nix b/pkgs/applications/science/misc/snakemake/default.nix index 1eded1e419c..3acd66f7908 100644 --- a/pkgs/applications/science/misc/snakemake/default.nix +++ b/pkgs/applications/science/misc/snakemake/default.nix @@ -5,14 +5,14 @@ python3.pkgs.buildPythonApplication rec { pname = "snakemake"; - version = "7.29.0"; + version = "7.32.4"; format = "setuptools"; src = fetchFromGitHub { owner = "snakemake"; repo = pname; rev = "refs/tags/v${version}"; - hash = "sha256-UfUzvDo5OE1LGCBBGoDpxG96RKOaShbqu5TOOILG3AY="; + hash = "sha256-9KuMPqvM8ZCTuomc0R9MBxsK3KIpukDTrlwU6MHysK0="; }; propagatedBuildInputs = with python3.pkgs; [ @@ -49,6 +49,7 @@ python3.pkgs.buildPythonApplication rec { pandas pytestCheckHook requests-mock + pillow ]; disabledTestPaths = [ @@ -56,6 +57,8 @@ python3.pkgs.buildPythonApplication rec { "tests/test_tes.py" "tests/test_tibanna.py" "tests/test_linting.py" + "tests/test_google_lifesciences.py" + "tests/test_conda_python_script/test_script.py" ]; disabledTests = [ diff --git a/pkgs/applications/science/misc/tulip/default.nix b/pkgs/applications/science/misc/tulip/default.nix index a2d3f3d9a2a..947cc2c7c3b 100644 --- a/pkgs/applications/science/misc/tulip/default.nix +++ b/pkgs/applications/science/misc/tulip/default.nix @@ -1,26 +1,32 @@ -{ fetchurl, lib, stdenv, libxml2, freetype, libGLU, libGL, glew -, qtbase, wrapQtAppsHook, python3 -, cmake, libjpeg }: +{ lib, stdenv, fetchurl, libxml2, freetype, libGLU, libGL, glew +, qtbase, wrapQtAppsHook, autoPatchelfHook, python3 +, cmake, libjpeg, llvmPackages }: stdenv.mkDerivation rec { pname = "tulip"; - version = "5.6.1"; + version = "5.7.2"; src = fetchurl { - url = "mirror://sourceforge/auber/${pname}-${version}_src.tar.gz"; - sha256 = "1fy3nvgxv3igwc1d23zailcgigj1d0f2kkh7a5j24c0dyqz5zxmw"; + url = "mirror://sourceforge/auber/tulip-${version}_src.tar.gz"; + hash = "sha256-b+XFCS6Ks+EpwxgYFzWdRomfCpHXmZHXnrQM+ZSLN/0="; }; - buildInputs = [ libxml2 freetype glew libGLU libGL libjpeg qtbase python3 ]; - nativeBuildInputs = [ cmake wrapQtAppsHook ]; + nativeBuildInputs = [ cmake wrapQtAppsHook ] + ++ lib.optionals stdenv.isLinux [ autoPatchelfHook ]; + + buildInputs = [ libxml2 freetype glew libjpeg qtbase python3 ] + ++ lib.optionals stdenv.isDarwin [ llvmPackages.openmp ] + ++ lib.optionals stdenv.isLinux [ libGLU libGL ]; qtWrapperArgs = [ ''--prefix PATH : ${lib.makeBinPath [ python3 ]}'' ]; + # error: format string is not a string literal (potentially insecure) + env.NIX_CFLAGS_COMPILE = lib.optionalString stdenv.isDarwin "-Wno-format-security"; + # FIXME: "make check" needs Docbook's DTD 4.4, among other things. doCheck = false; meta = { - broken = (stdenv.isLinux && stdenv.isAarch64); description = "A visualization framework for the analysis and visualization of relational data"; longDescription = @@ -36,6 +42,6 @@ stdenv.mkDerivation rec { license = lib.licenses.gpl3Plus; maintainers = [ ]; - platforms = lib.platforms.gnu ++ lib.platforms.linux; # arbitrary choice + platforms = lib.platforms.all; }; } diff --git a/pkgs/applications/science/molecular-dynamics/gromacs/default.nix b/pkgs/applications/science/molecular-dynamics/gromacs/default.nix index f6301ff6fce..2ca47d812bb 100644 --- a/pkgs/applications/science/molecular-dynamics/gromacs/default.nix +++ b/pkgs/applications/science/molecular-dynamics/gromacs/default.nix @@ -20,13 +20,17 @@ let in stdenv.mkDerivation rec { pname = "gromacs"; - version = "2023.2"; + version = "2023.3"; src = fetchurl { url = "ftp://ftp.gromacs.org/pub/gromacs/gromacs-${version}.tar.gz"; - sha256 = "sha256-vOFIByfksruQBBO3XZmjJm81B4d9pPWy1JHfeY+fza4="; + sha256 = "sha256-Tsj40MevdrE/j9FtuOLBIOdJ3kOa6VVNn2U/gS140cs="; }; + patches = [ ./pkgconfig.patch ]; + + outputs = [ "out" "dev" "man" ]; + nativeBuildInputs = [ cmake ]; buildInputs = [ @@ -64,10 +68,8 @@ in stdenv.mkDerivation rec { ] ) ++ lib.optional enableCuda "-DGMX_GPU=CUDA"; - postFixup = '' - substituteInPlace "$out"/lib/pkgconfig/*.pc \ - --replace '=''${prefix}//' '=/' \ - --replace "$out/$out/" "$out/" + postInstall = '' + moveToOutput share/cmake $dev ''; meta = with lib; { diff --git a/pkgs/applications/science/molecular-dynamics/gromacs/pkgconfig.patch b/pkgs/applications/science/molecular-dynamics/gromacs/pkgconfig.patch new file mode 100644 index 00000000000..6740d231236 --- /dev/null +++ b/pkgs/applications/science/molecular-dynamics/gromacs/pkgconfig.patch @@ -0,0 +1,24 @@ +diff --git a/src/external/muparser/muparser.pc.in b/src/external/muparser/muparser.pc.in +index 646787cb53..9b97ad57f7 100644 +--- a/src/external/muparser/muparser.pc.in ++++ b/src/external/muparser/muparser.pc.in +@@ -1,7 +1,5 @@ +-prefix=@CMAKE_INSTALL_PREFIX@ +-exec_prefix=${prefix} +-libdir=${prefix}/@CMAKE_INSTALL_LIBDIR@ +-includedir=${prefix}/@CMAKE_INSTALL_INCLUDEDIR@ ++libdir=@CMAKE_INSTALL_FULL_LIBDIR@ ++includedir=@CMAKE_INSTALL_FULL_INCLUDEDIR@ + + Name: @PACKAGE_NAME@ + Description: Mathematical expressions parser library +diff --git a/src/gromacs/libgromacs.pc.cmakein b/src/gromacs/libgromacs.pc.cmakein +index ec1ed6684e..ca1105474a 100644 +--- a/src/gromacs/libgromacs.pc.cmakein ++++ b/src/gromacs/libgromacs.pc.cmakein +@@ -1,4 +1,4 @@ +-libdir=@CMAKE_INSTALL_PREFIX@/@CMAKE_INSTALL_LIBDIR@ ++libdir=@CMAKE_INSTALL_FULL_LIBDIR@ + + Name: libgromacs@GMX_LIBS_SUFFIX@ + Description: Gromacs library diff --git a/pkgs/applications/science/molecular-dynamics/lammps/default.nix b/pkgs/applications/science/molecular-dynamics/lammps/default.nix index f11e9bdeeb1..7924d044c2a 100644 --- a/pkgs/applications/science/molecular-dynamics/lammps/default.nix +++ b/pkgs/applications/science/molecular-dynamics/lammps/default.nix @@ -44,15 +44,16 @@ }: stdenv.mkDerivation (finalAttrs: { - # LAMMPS has weird versioning converted to ISO 8601 format - version = "2Aug2023"; + # LAMMPS has weird versioning convention. Updates should go smoothly with: + # nix-update --commit lammps --version-regex 'stable_(.*)' + version = "2Aug2023_update1"; pname = "lammps"; src = fetchFromGitHub { owner = "lammps"; repo = "lammps"; rev = "stable_${finalAttrs.version}"; - hash = "sha256-6T4YAa4iN3pJpODGPW+faR16xxyYYdkHLavtiPUbZ4o="; + hash = "sha256-Zmn87a726qdidBfyvJlYleYv9jqyFAakxjGrg3lipc0="; }; preConfigure = '' cd cmake diff --git a/pkgs/applications/science/physics/xnec2c/default.nix b/pkgs/applications/science/physics/xnec2c/default.nix index 47fb7cf61df..87daa8cac85 100644 --- a/pkgs/applications/science/physics/xnec2c/default.nix +++ b/pkgs/applications/science/physics/xnec2c/default.nix @@ -2,6 +2,7 @@ , stdenv , fetchurl , autoreconfHook +, wrapGAppsHook , pkg-config , which , gtk3 @@ -20,7 +21,12 @@ stdenv.mkDerivation rec { hash = "sha256-6Yrx6LkJjfnMA/kJUDWLhGzGopZeecARSrcR++UScsU="; }; - nativeBuildInputs = [ autoreconfHook pkg-config which ]; + nativeBuildInputs = [ + autoreconfHook + wrapGAppsHook + pkg-config + which + ]; buildInputs = [ gtk3 blas lapack ]; meta = with lib; { diff --git a/pkgs/applications/science/robotics/qgroundcontrol/default.nix b/pkgs/applications/science/robotics/qgroundcontrol/default.nix index a57aec03013..0ff92337566 100644 --- a/pkgs/applications/science/robotics/qgroundcontrol/default.nix +++ b/pkgs/applications/science/robotics/qgroundcontrol/default.nix @@ -4,9 +4,9 @@ stdenv.mkDerivation rec { pname = "qgroundcontrol"; - version = "4.2.8"; + version = "4.2.9"; - qtInputs = [ + propagatedBuildInputs = [ qtbase qtcharts qtlocation qtserialport qtsvg qtquickcontrols2 qtgraphicaleffects qtspeech qtx11extras ]; @@ -20,7 +20,7 @@ stdenv.mkDerivation rec { wayland ]; - buildInputs = [ SDL2 ] ++ gstInputs ++ qtInputs; + buildInputs = [ SDL2 ] ++ gstInputs ++ propagatedBuildInputs; nativeBuildInputs = [ pkg-config qmake qttools wrapQtAppsHook ]; preConfigure = '' @@ -67,7 +67,7 @@ stdenv.mkDerivation rec { owner = "mavlink"; repo = pname; rev = "v${version}"; - sha256 = "sha256-EmGtVy/cHiZ2SqOOKmt9vCUQbyT5Sl8XnkRlhn9BdvA="; + sha256 = "sha256-nzBap5ldlLLLBB1ILkOktt9FnBqbo8MALLOETiqoAzk="; fetchSubmodules = true; }; |