summary refs log tree commit diff
diff options
context:
space:
mode:
Diffstat
-rw-r--r--CONTRIBUTING.md2
-rw-r--r--maintainers/maintainer-list.nix5
-rw-r--r--nixos/modules/services/security/fail2ban.nix6
-rw-r--r--pkgs/applications/science/biology/bowtie2/default.nix52
-rw-r--r--pkgs/by-name/hi/hifile/package.nix41
-rw-r--r--pkgs/by-name/tr/trealla/package.nix4
-rw-r--r--pkgs/development/compilers/flix/default.nix4
-rw-r--r--pkgs/development/python-modules/wallbox/default.nix4
-rw-r--r--pkgs/development/tools/misc/texlab/default.nix8
-rw-r--r--pkgs/stdenv/linux/default.nix2
-rw-r--r--pkgs/tools/admin/syft/default.nix6
-rw-r--r--pkgs/tools/misc/ckb-next/default.nix12
12 files changed, 115 insertions, 31 deletions
diff --git a/CONTRIBUTING.md b/CONTRIBUTING.md
index 32201333c37..06b9c10dfec 100644
--- a/CONTRIBUTING.md
+++ b/CONTRIBUTING.md
@@ -565,7 +565,7 @@ Names of files and directories should be in lowercase, with dashes between words
 
 - Do not use tab characters, i.e. configure your editor to use soft tabs. For instance, use `(setq-default indent-tabs-mode nil)` in Emacs. Everybody has different tab settings so it’s asking for trouble.
 
-- Use `lowerCamelCase` for variable names, not `UpperCamelCase`. Note, this rule does not apply to package attribute names, which instead follow the rules in [](#sec-package-naming).
+- Use `lowerCamelCase` for variable names, not `UpperCamelCase`. Note, this rule does not apply to package attribute names, which instead follow the rules in [package naming](./pkgs/README.md#package-naming).
 
 - Function calls with attribute set arguments are written as
 
diff --git a/maintainers/maintainer-list.nix b/maintainers/maintainer-list.nix
index 2296c8e4760..169ceae5585 100644
--- a/maintainers/maintainer-list.nix
+++ b/maintainers/maintainer-list.nix
@@ -19363,6 +19363,11 @@
     github = "ymeister";
     githubId = 47071325;
   };
+  ymstnt = {
+    name = "YMSTNT";
+    github = "ymstnt";
+    githubId = 21342713;
+  };
   yoavlavi = {
     email = "yoav@yoavlavi.com";
     github = "yoav-lavi";
diff --git a/nixos/modules/services/security/fail2ban.nix b/nixos/modules/services/security/fail2ban.nix
index 7059284850a..235f29ab8a6 100644
--- a/nixos/modules/services/security/fail2ban.nix
+++ b/nixos/modules/services/security/fail2ban.nix
@@ -103,9 +103,9 @@ in
       };
 
       bantime = mkOption {
-        default = null;
-        type = types.nullOr types.str;
-        example = "10m";
+        default = "10m";
+        type = types.str;
+        example = "1h";
         description = lib.mdDoc "Number of seconds that a host is banned.";
       };
 
diff --git a/pkgs/applications/science/biology/bowtie2/default.nix b/pkgs/applications/science/biology/bowtie2/default.nix
index e5c9c286422..356e90555f8 100644
--- a/pkgs/applications/science/biology/bowtie2/default.nix
+++ b/pkgs/applications/science/biology/bowtie2/default.nix
@@ -1,26 +1,62 @@
-{ lib, stdenv, fetchFromGitHub, cmake, tbb, zlib, python3, perl }:
+{ lib
+, stdenv
+, fetchFromGitHub
+, cmake
+, perl
+, python3
+, tbb
+, zlib
+, runCommand
+, bowtie2
+}:
 
-stdenv.mkDerivation rec {
+stdenv.mkDerivation (finalAttrs: {
   pname = "bowtie2";
   version = "2.5.2";
 
   src = fetchFromGitHub {
     owner = "BenLangmead";
-    repo = pname;
-    rev = "v${version}";
-    sha256 = "sha256-Bem4SHY/74suZPDbw/rwKMLBn3bRq5ooHbBoVnKuYk0=";
+    repo = "bowtie2";
+    rev = "refs/tags/v${finalAttrs.version}";
+    fetchSubmodules = true;
+    hash = "sha256-rWeopeYuCk9ZhJX2SFCcxZWcjXjjTiVRiwkzLQcIgd0=";
   };
 
+  # because of this flag, gcc on aarch64 cannot find the Threads
+  # Could NOT find Threads (missing: Threads_FOUND)
+  # TODO: check with other distros and report upstream
+  postPatch = ''
+    substituteInPlace CMakeLists.txt \
+      --replace "-m64" ""
+  '';
+
   nativeBuildInputs = [ cmake ];
 
   buildInputs = [ tbb zlib python3 perl ];
 
+  cmakeFlags = lib.optional (!stdenv.hostPlatform.isx86) ["-DCMAKE_CXX_FLAGS=-I${finalAttrs.src}/third_party"];
+
+  # ctest fails because of missing dependencies between tests
+  doCheck = false;
+
+  passthru.tests = {
+    ctest = runCommand "${finalAttrs.pname}-test" { } ''
+      mkdir $out
+      ${lib.getExe bowtie2} -x ${finalAttrs.src}/example/index/lambda_virus ${finalAttrs.src}/example/reads/longreads.fq -u 10
+      ${bowtie2}/bin/bowtie2-build-s -c GGGCGGCGACCTCGCGGGTTTTCGCTA $out/small
+      ${bowtie2}/bin/bowtie2-inspect-s $out/small
+      ${bowtie2}/bin/bowtie2-build-l -c GGGCGGCGACCTCGCGGGTTTTCGCTA $out/large
+      ${bowtie2}/bin/bowtie2-inspect-l $out/large
+    '';
+  };
+
   meta = with lib; {
     description = "An ultrafast and memory-efficient tool for aligning sequencing reads to long reference sequences";
-    license = licenses.gpl3;
+    license = licenses.gpl3Plus;
     homepage = "http://bowtie-bio.sf.net/bowtie2";
+    changelog = "https://github.com/BenLangmead/bowtie2/releases/tag/${finalAttrs.src.rev}";
     maintainers = with maintainers; [ rybern ];
     platforms = platforms.all;
-    broken = stdenv.isAarch64; # only x86 is supported
+    mainProgram = "bowtie2";
   };
-}
+})
diff --git a/pkgs/by-name/hi/hifile/package.nix b/pkgs/by-name/hi/hifile/package.nix
new file mode 100644
index 00000000000..bf2bda5100d
--- /dev/null
+++ b/pkgs/by-name/hi/hifile/package.nix
@@ -0,0 +1,41 @@
+{ lib, appimageTools, fetchurl }:
+
+let
+  version = "0.9.9.5";
+  pname = "hifile";
+
+  src = fetchurl {
+    url = "https://www.hifile.app/files/HiFile-${version}.AppImage";
+    hash = "sha256-Ks/NLPm5loo9q8pT0LdtfcrC38203beNE74sbEpyuJM=";
+  };
+
+  appimageContents = appimageTools.extractType2 {
+    inherit pname version src;
+  };
+
+in
+appimageTools.wrapType2 rec {
+  inherit pname version src;
+
+  extraInstallCommands = ''
+    mv $out/bin/${pname}-${version} $out/bin/${pname}
+
+    install -m 444 -D ${appimageContents}/HiFile.desktop $out/share/applications/HiFile.desktop
+    install -m 444 -D ${appimageContents}/HiFile.png $out/share/icons/hicolor/512x512/apps/HiFile.png
+    substituteInPlace $out/share/applications/HiFile.desktop \
+      --replace 'Exec=HiFile' 'Exec=${pname}'
+  '';
+
+  meta = with lib; {
+    description = "Dual-pane graphical file manager for Windows, macOS and Linux";
+    longDescription = ''
+      HiFile is the next evolution of file managers. Its mission is to increase your productivity whenever you work with files or folders. It aims to be better in every way - more convenient, more versatile, more efficient, more elegant, more customizable, and more fun.
+    '';
+    homepage = "https://www.hifile.app/";
+    downloadPage = "https://www.hifile.app/download";
+    license = licenses.unfree;
+    sourceProvenance = with sourceTypes; [ binaryNativeCode ];
+    maintainers = with maintainers; [ ymstnt ];
+    platforms = [ "x86_64-linux" ];
+  };
+}
diff --git a/pkgs/by-name/tr/trealla/package.nix b/pkgs/by-name/tr/trealla/package.nix
index 1a9d5569f23..6aee9c1598b 100644
--- a/pkgs/by-name/tr/trealla/package.nix
+++ b/pkgs/by-name/tr/trealla/package.nix
@@ -17,13 +17,13 @@
 assert lib.elem lineEditingLibrary [ "isocline" "readline" ];
 stdenv.mkDerivation (finalAttrs: {
   pname = "trealla";
-  version = "2.28.12";
+  version = "2.29.36";
 
   src = fetchFromGitHub {
     owner = "trealla-prolog";
     repo = "trealla";
     rev = "v${finalAttrs.version}";
-    hash = "sha256-uWCpCjYFtK2pNeHHZWhWI6YZ+cllQpkKz//nHracl5s=";
+    hash = "sha256-tQp2DOBW71Wm1aQqspW9tuH8aM8ir+ilZiENdElB/+0=";
   };
 
   postPatch = ''
diff --git a/pkgs/development/compilers/flix/default.nix b/pkgs/development/compilers/flix/default.nix
index 47a84a6e5f2..9ce582623fe 100644
--- a/pkgs/development/compilers/flix/default.nix
+++ b/pkgs/development/compilers/flix/default.nix
@@ -2,11 +2,11 @@
 
 stdenvNoCC.mkDerivation rec {
   pname = "flix";
-  version = "0.40.0";
+  version = "0.41.0";
 
   src = fetchurl {
     url = "https://github.com/flix/flix/releases/download/v${version}/flix.jar";
-    sha256 = "sha256-NVQY2TgIR9ROy4x8PWxCjuaOkNx0bcUA4oZHjpQbHc4=";
+    sha256 = "sha256-bDeqwk+grkCxmGE9H8Ks7Q8KvLxNCzaLe44DlR6E7YE=";
   };
 
   dontUnpack = true;
diff --git a/pkgs/development/python-modules/wallbox/default.nix b/pkgs/development/python-modules/wallbox/default.nix
index 4fe26418ef8..a53344a76fd 100644
--- a/pkgs/development/python-modules/wallbox/default.nix
+++ b/pkgs/development/python-modules/wallbox/default.nix
@@ -9,14 +9,14 @@
 
 buildPythonPackage rec {
   pname = "wallbox";
-  version = "0.4.14";
+  version = "0.5.1";
   format = "setuptools";
 
   disabled = pythonOlder "3.7";
 
   src = fetchPypi {
     inherit pname version;
-    hash = "sha256-HKlq5DPG3HD9i9LLTJdlzEFim+2hBdSfKl43BojhEf8=";
+    hash = "sha256-EDEB7/CkrfYSNcSh55Itrj6rThsNKeuj8lHLAY+Qml4=";
   };
 
   propagatedBuildInputs = [
diff --git a/pkgs/development/tools/misc/texlab/default.nix b/pkgs/development/tools/misc/texlab/default.nix
index e33a288286e..9bc36338ff2 100644
--- a/pkgs/development/tools/misc/texlab/default.nix
+++ b/pkgs/development/tools/misc/texlab/default.nix
@@ -15,16 +15,16 @@ let
 in
 rustPlatform.buildRustPackage rec {
   pname = "texlab";
-  version = "5.10.0";
+  version = "5.10.1";
 
   src = fetchFromGitHub {
     owner = "latex-lsp";
     repo = "texlab";
     rev = "refs/tags/v${version}";
-    hash = "sha256-MTWaGgDIDo3CaRHyHWqliKsPdbU/TZPsyfF7SoHTnhk=";
+    hash = "sha256-ACdiFkV138jDIrRe+baYo+r9vCO4cyRyO2ck7OKakFY=";
   };
 
-  cargoHash = "sha256-8Vrp4d5luf91pKpUC4wWn4otsanqopCHwCjcnfTzyLk=";
+  cargoHash = "sha256-bEeQOOucXd4HNTR6SmidAfDkZ1tT7ORmUxrNx+3FNRw=";
 
   outputs = [ "out" ] ++ lib.optional (!isCross) "man";
 
@@ -41,7 +41,7 @@ rustPlatform.buildRustPackage rec {
   # generate the man page
   postInstall = lib.optionalString (!isCross) ''
     # TexLab builds man page separately in CI:
-    # https://github.com/latex-lsp/texlab/blob/v5.9.2/.github/workflows/publish.yml#L117-L121
+    # https://github.com/latex-lsp/texlab/blob/v5.10.1/.github/workflows/publish.yml#L117-L121
     help2man --no-info "$out/bin/texlab" > texlab.1
     installManPage texlab.1
   '';
diff --git a/pkgs/stdenv/linux/default.nix b/pkgs/stdenv/linux/default.nix
index 5c03312cc75..35cdb6311df 100644
--- a/pkgs/stdenv/linux/default.nix
+++ b/pkgs/stdenv/linux/default.nix
@@ -68,7 +68,7 @@
       mipsel-linux = import ./bootstrap-files/mipsel-unknown-linux-gnu.nix;
       mips64el-linux = import
        (if localSystem.isMips64n32
-        then ./bootstrap-files/mips64el-unknown-linux-gnuabin32.nix.nix
+        then ./bootstrap-files/mips64el-unknown-linux-gnuabin32.nix
         else ./bootstrap-files/mips64el-unknown-linux-gnuabi64.nix);
       powerpc64le-linux = import ./bootstrap-files/powerpc64le-unknown-linux-gnu.nix;
       riscv64-linux = import ./bootstrap-files/riscv64-unknown-linux-gnu.nix;
diff --git a/pkgs/tools/admin/syft/default.nix b/pkgs/tools/admin/syft/default.nix
index 3f6567b09f0..c596c709977 100644
--- a/pkgs/tools/admin/syft/default.nix
+++ b/pkgs/tools/admin/syft/default.nix
@@ -2,13 +2,13 @@
 
 buildGoModule rec {
   pname = "syft";
-  version = "0.92.0";
+  version = "0.93.0";
 
   src = fetchFromGitHub {
     owner = "anchore";
     repo = pname;
     rev = "v${version}";
-    hash = "sha256-YmzizpcAfE4+Rfq5ydQnDQBo4R+pAyudfi+fqD9EZP0=";
+    hash = "sha256-e8d+CK7rRbyHeRHOjK3tGFIBHuosdV4AMetUQar54E4=";
     # populate values that require us to use git. By doing this in postFetch we
     # can delete .git afterwards and maintain better reproducibility of the src.
     leaveDotGit = true;
@@ -22,7 +22,7 @@ buildGoModule rec {
   };
   # hash mismatch with darwin
   proxyVendor = true;
-  vendorHash = "sha256-siOZWhHqNokkYAPwuXQCs4T1yBiEWUTJzhfbH/Z2uBk=";
+  vendorHash = "sha256-BUCe2v80tHAqMBwa6xae3ZOTOok8msM6hFh6d9D4xZA=";
 
   nativeBuildInputs = [ installShellFiles ];
 
diff --git a/pkgs/tools/misc/ckb-next/default.nix b/pkgs/tools/misc/ckb-next/default.nix
index f9309ecf81d..549cb543af1 100644
--- a/pkgs/tools/misc/ckb-next/default.nix
+++ b/pkgs/tools/misc/ckb-next/default.nix
@@ -1,17 +1,17 @@
-{ lib, mkDerivation, fetchFromGitHub, substituteAll, udev, stdenv
+{ lib, wrapQtAppsHook, fetchFromGitHub, substituteAll, udev, stdenv
 , pkg-config, qtbase, cmake, zlib, kmod, libXdmcp, qttools, qtx11extras, libdbusmenu
-, withPulseaudio ? stdenv.isLinux, libpulseaudio
+, withPulseaudio ? stdenv.isLinux, libpulseaudio, quazip
 }:
 
-mkDerivation rec {
-  version = "0.5.0";
+stdenv.mkDerivation rec {
+  version = "0.6.0";
   pname = "ckb-next";
 
   src = fetchFromGitHub {
     owner = "ckb-next";
     repo = "ckb-next";
     rev = "v${version}";
-    sha256 = "sha256-yR1myagAqavAR/7lPdufcrJpPmXW7r4N4pxTMF6NbuE=";
+    hash = "sha256-G0cvET3wMIi4FlBmaTkdTyYtcdVGzK4X0C2HYZr43eg=";
   };
 
   buildInputs = [
@@ -22,9 +22,11 @@ mkDerivation rec {
     qttools
     qtx11extras
     libdbusmenu
+    quazip
   ] ++ lib.optional withPulseaudio libpulseaudio;
 
   nativeBuildInputs = [
+    wrapQtAppsHook
     pkg-config
     cmake
   ];
generated by cgit-pink 1.4.1 (git 2.36.1) at 2024-06-29 12:17:56 +0000